Case summary:
Mr. J dies of a massive myocardial infarction which is triggered by coronary thrombosis. After an autopsy, necrotic myocardium is found in the lateral and posterior right ventricle and posterior interventricular septum.
Adequate information:
The muscular wall of the heart is known as myocardium. It helps in contraction and relaxation of the heart muscle the contraction of muscles results in pumping the blood out of the heart, whereas relaxation of muscle results in a refill of the chamber of the heart. The myocardium is composed of two membranes epicardium (outer membrane) and endocardium (inner membrane).
To determine:
The place of occurrence of thrombosis in the coronary circulation.
Given Information:
The person dies of myocardial infarction. After an autopsy, the reason for myocardial infarction is found as necrotic myocardium. It blocks the lateral and posterior right ventricle and posterior interventricular septum.

Want to see the full answer?
Check out a sample textbook solution
Chapter 20 Solutions
Connect Online Access for Saladin Human Anatomy
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
