
Biology
3rd Edition
ISBN: 9781259824913
Author: Hoefnagels, Mariëlle
Publisher: Mcgraw-hill Education,
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 2, Problem 6WIO
Summary Introduction
To determine:
The nonpolar molecules such as CH4 participate in hydrogen bonds.
Introduction:
The molecule methane is made of atoms that are joined by covalent bonds. For example, in methane (CH4), a carbon atom contains 6 electrons, in which 2 presents in the innermost shell and the remaining 4 presents in the valence shell. This carbon atom becomes stable by sharing the electrons with 4 hydrogen atoms as per the octet rules, i.e., all atoms in a molecule need 8 electrons in the valence shell, either by sharing, gaining, or losing electrons, to get stable.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 2 Solutions
Biology
Ch. 2.1 - Which four chemical elements do organisms require...Ch. 2.1 - Prob. 2MCCh. 2.1 - Prob. 3MCCh. 2.1 - Prob. 4MCCh. 2.1 - How are the isotopes of an element different from...Ch. 2.2 - How are atoms, molecules, and compounds related?Ch. 2.2 - How does the number of valence electrons determine...Ch. 2.2 - Prob. 3MCCh. 2.3 - Prob. 1MCCh. 2.3 - Prob. 2MC
Ch. 2.3 - Prob. 3MCCh. 2.3 - Prob. 4MCCh. 2.3 - Prob. 5MCCh. 2.3 - Prob. 6MCCh. 2.4 - Prob. 1MCCh. 2.4 - Prob. 2MCCh. 2.4 - Prob. 3MCCh. 2.5 - Prob. 1MCCh. 2.5 - Prob. 2MCCh. 2.5 - Prob. 3MCCh. 2.5 - What are some differences between RNA and DNA?Ch. 2.5 - Prob. 5MCCh. 2.5 - Prob. 6MCCh. 2.5 - List an example of a carbohydrate, protein,...Ch. 2 - Prob. 1MCQCh. 2 - How many neutrons does a carbon-14 atom have in...Ch. 2 - An ionic bond forms when a. an electrical...Ch. 2 - Prob. 4MCQCh. 2 - Prob. 5MCQCh. 2 - A hydrogen bond is distinct from ionic and...Ch. 2 - A hydrophilic substance is one that can a. form...Ch. 2 - Prob. 8MCQCh. 2 - Prob. 9MCQCh. 2 - ______ are monomers that form polymers called...Ch. 2 - Describe how the number of protons, neutrons, and...Ch. 2 - The vitamin biotin contains 10 atoms of carbon, 16...Ch. 2 - Prob. 3WIOCh. 2 - Distinguish between nonpolar covalent bonds, polar...Ch. 2 - Prob. 5WIOCh. 2 - Prob. 6WIOCh. 2 - Prob. 7WIOCh. 2 - Prob. 8WIOCh. 2 - Prob. 9WIOCh. 2 - Define solute, solvent, and solution.Ch. 2 - How do hydrogen ions relate to the pH scale?Ch. 2 - Prob. 12WIOCh. 2 - Prob. 13WIOCh. 2 - Prob. 14WIOCh. 2 - Complete and explain the following analogy: a...Ch. 2 - Prob. 16WIOCh. 2 - You eat a sandwich made of starchy bread, ham, and...Ch. 2 - Prob. 18WIOCh. 2 - Review Burning Question 2.2, which describes the...Ch. 2 - Review Why We Care 2.1, which describes acids and...Ch. 2 - Compare the Survey the Landscape figure in the...Ch. 2 - How do ions and isotopes fit into this concept...Ch. 2 - Prob. 3PITCh. 2 - Prob. 4PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license