
Concept explainers
To predict:
The effect of additional mountain building in the Rocky Mountains on the levels of phosphorus in the surrounding valleys
Introduction : Phosphorus cycle is a mineral cycle. It is very important cycle for the ecosystem.
Phosphorus cycle has a short term cycle and a long term cycle. It is an element that is essential for growth and development of organisms.

Answer to Problem 37A
If additional mountain building comes up in the Rocky Mountains, the levels of phosphorus in the surrounding valleys will increase which will further increase the growth of plants and animals.
Explanation of Solution
The above illustration represents a phosphorus cycle. Phosphorus is an element that is essential for growth and development of organisms. The cycle has a short term cycle and a long term cycle. In the short-term cycle, phosphorus in the form of phosphates is cycled from producers to consumers. When the organisms die or produce waste products, decomposers return the phosphorus back to the soil where it can be reused. It moves from short term cycle to long term cycle through sedimentation to form rocks. Weathering of rocks that contain phosphorus returns the element to the cycle. So when a new mountain building comes up in Rocky Mountains, the levels of phosphorus will increase in the valleys due to erosion and weathering of mountain rocks. The increased levels of phosphorus will boost the growth and developments of plants and animals.
Chapter 2 Solutions
Biology Illinois Edition (Glencoe Science)
Additional Science Textbook Solutions
Biology: Life on Earth (11th Edition)
Campbell Biology (11th Edition)
College Physics: A Strategic Approach (3rd Edition)
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Chemistry
Chemistry: Structure and Properties (2nd Edition)
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





