
Concept explainers
To distinguish:
Between everyday use of the term theory and its true scientific meaning.
Introduction: All scientists and biologists follow the same basic steps to do research and answer queries. These are called scientific methods. They conduct experiments, collect data, make hypothesis and gather evidences. Theory is a term commonly used in everyday life but it is used differently by scientists.

Answer to Problem 12STP
In everyday use, the term theory is just used for an idea or to explain something. It is not supported by evidences.
In scientific terms, a theory is a summary of an idea that brings together many observations and experiments in science.
Explanation of Solution
In everyday use, the term theory is simply a guess or an idea about something without any supporting evidence. It can be just a speculation or hunch about something. There are no evidences or explanation to support it.
In science, the term theory has just an opposite meaning. Scientists gather information from various experiments. They analyze the data from hypothesis. The experiments are conducted over and over again to gather more data. They also compare the results of their experiments with the results of other studies. The results are also published in science journals so that the scientists can compare different results. After many repeated experiments when the results are similar, the hypothesis gets support. When a hypothesis is supported by many investigations and observations, it becomes a theory.
Theory is an explanation of a natural phenomenon or event that is supported by a large number of scientific evidences obtained from various investigations and observations. In biology, there are two most important theories; cell theory and theory of evolution.
Chapter 2 Solutions
Biology Illinois Edition (Glencoe Science)
Additional Science Textbook Solutions
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Chemistry: Structure and Properties (2nd Edition)
Human Anatomy & Physiology (2nd Edition)
Microbiology with Diseases by Body System (5th Edition)
Applications and Investigations in Earth Science (9th Edition)
Biology: Life on Earth (11th Edition)
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





