
To replace:
The italicized word with a correct vocabulary term in the given sentence
Introduction : The exchange of matter through the biosphere is called biogeochemical cycle. It involves living organisms, geological processes and chemical processes.

Answer to Problem 29A
The movement of chemicals on a global scale from abiotic through biotic parts of the environment is a biogeochemical cycle.
Explanation of Solution
Plants obtain the nutrients from soil, water and air which are then converted to various organic compounds. The nutrients flow through different organisms in the ecosystem. The exchange of nutrients through the biosphere is called biogeochemical cycle. The chemicals or nutrients move from abiotic part of the ecosystem which consists of air, soil and water, to biotic part of ecosystem which consists of plants, animals and decomposers. Lithospheric process is related to changes on the surface of Earth. Hence, this is not the correct word for movement of chemicals from abiotic to biotic parts of the environment.
Chapter 2 Solutions
Biology Illinois Edition (Glencoe Science)
Additional Science Textbook Solutions
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Microbiology: An Introduction
Campbell Biology (11th Edition)
Applications and Investigations in Earth Science (9th Edition)
Chemistry: Structure and Properties (2nd Edition)
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





