
To determine:
The error in the given sentence.
Introduction:
The study of relationships among different living organisms and interactions among these organisms with the environment is termed as ecology. Ecology takes place in the biosphere, which is the percentage of the earth that sustains life.

Explanation of Solution
The given sentence is:
A niche is the place in which an organism lives.
A habitat is the area where an organism lives. For an organism, a habitat can be a tree also, where the organism spends its whole life. If an organism moves from one tree to another tree, then the habitat of that organism would be a groove.
The role of an organism in the given environment is its niche. An organism’s niche is the way by which it completes its demand for shelter, food, and reproduction.
Want to see more full solutions like this?
Chapter 2 Solutions
Biology Illinois Edition (Glencoe Science)
Additional Science Textbook Solutions
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Human Anatomy & Physiology (2nd Edition)
Anatomy & Physiology (6th Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
Introductory Chemistry (6th Edition)
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





