
Anatomy and Physiology: An Integrative Approach with Connect Access Card
3rd Edition
ISBN: 9781260254440
Author: Michael McKinley, Valerie O'Loughlin, Theresa Bidle
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 18.4, Problem 23LO
Summary Introduction
To describe: The result when platelets encounter damage in a blood vessel.
Concept introduction: Blood is a connective tissue which flows from the heart through arteries and veins to all body parts. Blood consists of two components: formed elements and plasma. Erythrocytes, leukocytes, and platelets are the formed elements of blood. Platelets, which are also called as thrombocytes, are the membrane-bound cell fragments. They are irregular shaped, enclosed by membrane, and have diameter about 2µm. They do not have a nucleus, so they are not considered as true cells.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 18 Solutions
Anatomy and Physiology: An Integrative Approach with Connect Access Card
Ch. 18.1 - Prob. 1LOCh. 18.1 - Prob. 1WDLCh. 18.1 - How does blood help regulate body temperature and...Ch. 18.1 - Prob. 2LOCh. 18.1 - Prob. 1WDTCh. 18.1 - Will blood be able to properly carry out its...Ch. 18.1 - Prob. 3LOCh. 18.1 - Prob. 4LOCh. 18.1 - Prob. 5LOCh. 18.1 - Prob. 4WDL
Ch. 18.1 - Prob. 5WDLCh. 18.2 - Prob. 6LOCh. 18.2 - Prob. 7LOCh. 18.2 - Prob. 6WDLCh. 18.2 - Prob. 7WDLCh. 18.2 - Prob. 8LOCh. 18.2 - Prob. 8WDLCh. 18.3 - Prob. 9LOCh. 18.3 - Prob. 10LOCh. 18.3 - Prob. 11LOCh. 18.3 - Prob. 12LOCh. 18.3 - Describe the process of erythropoiesis, beginning...Ch. 18.3 - What are the two main types of precursor cells for...Ch. 18.3 - Prob. 13LOCh. 18.3 - Prob. 14LOCh. 18.3 - Prob. 15LOCh. 18.3 - Prob. 16LOCh. 18.3 - Prob. 2WDTCh. 18.3 - WHAT DO YOU THINK?
3 Why is an individual with...Ch. 18.3 - Prob. 11WDLCh. 18.3 - Prob. 12WDLCh. 18.3 - Prob. 13WDLCh. 18.3 - Prob. 17LOCh. 18.3 - LEARNING OBJECTIVE
18. Distinguish between...Ch. 18.3 - Prob. 19LOCh. 18.3 - Prob. 14WDLCh. 18.3 - Prob. 15WDLCh. 18.3 - Prob. 20LOCh. 18.3 - Prob. 16WDLCh. 18.4 - Prob. 21LOCh. 18.4 - Prob. 22LOCh. 18.4 - Prob. 17WDLCh. 18.4 - Prob. 23LOCh. 18.4 - Prob. 4WDTCh. 18.4 - Prob. 18WDLCh. 18.4 - Prob. 19WDLCh. 18.4 - Prob. 24LOCh. 18.4 - Prob. 25LOCh. 18.4 - Prob. 26LOCh. 18.4 - Prob. 20WDLCh. 18.4 - At what point in blood loss is the sympathetic...Ch. 18.4 - Prob. 27LOCh. 18.4 - Prob. 5WDTCh. 18.4 - Prob. 22WDLCh. 18.5 - Prob. 28LOCh. 18.5 - Prob. 29LOCh. 18.5 - Prob. 23WDLCh. 18.5 - Prob. 24WDLCh. 18 - Prob. 1DYBCh. 18 - _____ 2. Which type of leukocyte increases during...Ch. 18 - Prob. 3DYBCh. 18 - Prob. 4DYBCh. 18 - Prob. 5DYBCh. 18 - Prob. 6DYBCh. 18 - Prob. 7DYBCh. 18 - _____ 8. During the recycling of components...Ch. 18 - _____ 9. The extrinsic pathway of coagulation is...Ch. 18 - _____ 10. A clot is best described as a. an...Ch. 18 - How does blood help regulate body temperature?Ch. 18 - What are alpha- and beta-globulins? What do they...Ch. 18 - When blood is centrifuged, a thin, whitish-gray...Ch. 18 - What is the shape of an erythrocyte, and why is...Ch. 18 - How are respiratory gases (oxygen and carbon...Ch. 18 - What are the anatomic characteristics of each type...Ch. 18 - How do the functions of basophils differ from...Ch. 18 - Briefly describe the origin, structure, and...Ch. 18 - Prob. 19DYBCh. 18 - Describe the three phases of hemostasis, and list...Ch. 18 - Use the following paragraph to answer questions...Ch. 18 - Prob. 2CALCh. 18 - Which sequence or pathway best describes the...Ch. 18 - Prob. 4CALCh. 18 - Prob. 5CALCh. 18 - While taking a clinical laboratory class, Marilyn...Ch. 18 - Abby is a nurse on duty in a hospital emergency...Ch. 18 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education