Anatomy and Physiology: An Integrative Approach with Connect Access Card
Anatomy and Physiology: An Integrative Approach with Connect Access Card
3rd Edition
ISBN: 9781260254440
Author: Michael McKinley, Valerie O'Loughlin, Theresa Bidle
Publisher: McGraw-Hill Education
bartleby

Concept explainers

Question
Book Icon
Chapter 18.4, Problem 23LO
Summary Introduction

To describe: The result when platelets encounter damage in a blood vessel.

Concept introduction: Blood is a connective tissue which flows from the heart through arteries and veins to all body parts. Blood consists of two components: formed elements and plasma. Erythrocytes, leukocytes, and platelets are the formed elements of blood. Platelets, which are also called as thrombocytes, are the membrane-bound cell fragments. They are irregular shaped, enclosed by membrane, and have diameter about 2µm. They do not have a nucleus, so they are not considered as true cells.

Blurred answer
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?

Chapter 18 Solutions

Anatomy and Physiology: An Integrative Approach with Connect Access Card

Ch. 18.1 - Prob. 5WDLCh. 18.2 - Prob. 6LOCh. 18.2 - Prob. 7LOCh. 18.2 - Prob. 6WDLCh. 18.2 - Prob. 7WDLCh. 18.2 - Prob. 8LOCh. 18.2 - Prob. 8WDLCh. 18.3 - Prob. 9LOCh. 18.3 - Prob. 10LOCh. 18.3 - Prob. 11LOCh. 18.3 - Prob. 12LOCh. 18.3 - Describe the process of erythropoiesis, beginning...Ch. 18.3 - What are the two main types of precursor cells for...Ch. 18.3 - Prob. 13LOCh. 18.3 - Prob. 14LOCh. 18.3 - Prob. 15LOCh. 18.3 - Prob. 16LOCh. 18.3 - Prob. 2WDTCh. 18.3 - WHAT DO YOU THINK? 3 Why is an individual with...Ch. 18.3 - Prob. 11WDLCh. 18.3 - Prob. 12WDLCh. 18.3 - Prob. 13WDLCh. 18.3 - Prob. 17LOCh. 18.3 - LEARNING OBJECTIVE 18. Distinguish between...Ch. 18.3 - Prob. 19LOCh. 18.3 - Prob. 14WDLCh. 18.3 - Prob. 15WDLCh. 18.3 - Prob. 20LOCh. 18.3 - Prob. 16WDLCh. 18.4 - Prob. 21LOCh. 18.4 - Prob. 22LOCh. 18.4 - Prob. 17WDLCh. 18.4 - Prob. 23LOCh. 18.4 - Prob. 4WDTCh. 18.4 - Prob. 18WDLCh. 18.4 - Prob. 19WDLCh. 18.4 - Prob. 24LOCh. 18.4 - Prob. 25LOCh. 18.4 - Prob. 26LOCh. 18.4 - Prob. 20WDLCh. 18.4 - At what point in blood loss is the sympathetic...Ch. 18.4 - Prob. 27LOCh. 18.4 - Prob. 5WDTCh. 18.4 - Prob. 22WDLCh. 18.5 - Prob. 28LOCh. 18.5 - Prob. 29LOCh. 18.5 - Prob. 23WDLCh. 18.5 - Prob. 24WDLCh. 18 - Prob. 1DYBCh. 18 - _____ 2. Which type of leukocyte increases during...Ch. 18 - Prob. 3DYBCh. 18 - Prob. 4DYBCh. 18 - Prob. 5DYBCh. 18 - Prob. 6DYBCh. 18 - Prob. 7DYBCh. 18 - _____ 8. During the recycling of components...Ch. 18 - _____ 9. The extrinsic pathway of coagulation is...Ch. 18 - _____ 10. A clot is best described as a. an...Ch. 18 - How does blood help regulate body temperature?Ch. 18 - What are alpha- and beta-globulins? What do they...Ch. 18 - When blood is centrifuged, a thin, whitish-gray...Ch. 18 - What is the shape of an erythrocyte, and why is...Ch. 18 - How are respiratory gases (oxygen and carbon...Ch. 18 - What are the anatomic characteristics of each type...Ch. 18 - How do the functions of basophils differ from...Ch. 18 - Briefly describe the origin, structure, and...Ch. 18 - Prob. 19DYBCh. 18 - Describe the three phases of hemostasis, and list...Ch. 18 - Use the following paragraph to answer questions...Ch. 18 - Prob. 2CALCh. 18 - Which sequence or pathway best describes the...Ch. 18 - Prob. 4CALCh. 18 - Prob. 5CALCh. 18 - While taking a clinical laboratory class, Marilyn...Ch. 18 - Abby is a nurse on duty in a hospital emergency...Ch. 18 - Prob. 3CSL
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education