Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780321962751
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 18.3, Problem 2CC
Summary Introduction
To describe:
The information given on the website: https://gold.jgpi-psf.org/statistics and also to give percent of bacterial genome projects that have medical relevance.
Introduction:
The genome online database (GOLD) is a website of Joint Genome Institute that gives information about genome sequencing projects.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Watch the following video called "Human Genome Project Video" (https://fod.infobase.com/OnDemandEmbed.aspx?lti=1&token=30037&wID=97629&loid=0&w=400&h=300) then answer the following question in one paragraph each with evidence from the film to support your answers.
1) In one paragraph, explain in detail the purpose of decoding the entire human genome according to what you have seen from the provided link video, read online or read from the book.
2) In one paragraph, explain how has decoding the human genome been used in medicine? Give a couple of examples from the provided video link and provide a detailed explanation.
Based on the images attached, what does the similarity in the sequences tell you about the ermB gene found in these bacteria? Would we expect high or low sequence similarity when considering the possibility of horizontal gene transfer?
The following DNA sequences were used to generate a contig from a genome sequencing project.
ttcagattttccccg
gctaaagctccgaa
gccattaacgcc
tttagcatactacggcgtta
aaaaccggggaaaat
tccgaatcggtcattcaga
How long is the fully assembled contig?
Chapter 18 Solutions
Campbell Biology in Focus (2nd Edition)
Ch. 18.1 - Prob. 1CCCh. 18.2 - Prob. 1CCCh. 18.2 - Explain the advantage of the systems biology...Ch. 18.2 - Prob. 3CCCh. 18.3 - The best estimate is that the human genome...Ch. 18.3 - Prob. 2CCCh. 18.3 - Prob. 3CCCh. 18.4 - Discuss the characteristics of mammalian genomes...Ch. 18.4 - Which of the three mechanisms described in Figures...Ch. 18.4 - Prob. 3CC
Ch. 18.5 - Describe three examples of errors in cellular...Ch. 18.5 - Prob. 2CCCh. 18.5 - Prob. 3CCCh. 18.6 - Would you expect the genome of the macaque (a...Ch. 18.6 - Prob. 2CCCh. 18 - Prob. 1TYUCh. 18 - Prob. 2TYUCh. 18 - Two eukaryotic proteins have one domain in common...Ch. 18 - SCIENTIFIC INQUIRY The scientists mapping human...Ch. 18 - FOCUS ON EVOLUTION Genes important in the...Ch. 18 - FOCUS ON INFORMATION The continuity of life is...Ch. 18 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Please answer the following questions using numbers and not text. For example, if you think the answer is 24, write 24 and not twenty-four. If you think the answer is 24 ATP, write only the number 24. As a microbiology technician, your job is to characterize a novel bacterial strain isolated from insects. Phenotypically, you have discovered that the new bacterial strain can grow in the presence or absence of oxygen. After genome sequencing and biochemical characterization, you know that your new organism is capable of making all of the enzymes necessary for glycolysis and the TCA cycle, and that it has an electron transport chain. Answer the following questions based on the growth of your organism on minimal media plates containing only acetate as a carbon and energy source. Acetate is transported across the membrane at the cost of 3 ATP per molecule. Each question should be answered based on the metabolism of one molecule of acetate. If you come up with a negative value, indicate an…arrow_forwardFrom the results of your BLAST search you can link to the GENE entry for one of your top hits. This link is located under the “Related Information” heading at the right hand side of each displayed alignment (i.e. scroll down to the“Alignments” section). Q1: How many exons and introns are annotated for this gene? Q2: What is the function of the encoded protein?arrow_forwardWhat exactly is the purpose of the programme Finch TV? Examining the results of sequencing of the next generation It is necessary to use the.bam file extension in order to access sequencing files. For sanger sequencing files, the.ab1 file extension is required in order to open them. It is possible to open NGS files by using the.ab1 file extension.arrow_forward
- The illumina method of sequencing uses a unique type of nucleotide building block. What is the specific characteristic of this type of nucleotide that is important for this method of sequencing? How is the sequence of a fragment of DNA determined using this method? (USE THIS LINK AND WRITE ANSWERS IN YOUR LANGUAGE PLEASE DON'T COPY SAME AS GIVEN IN SITE https://www.mybiosource.com/learn/testing-procedures/dna-sequencing/arrow_forwardYou are screen sharing Here is part of a gene: 5' TTTAATGGTAACCGTATTGCAGCTATTAGCATAAATG 3' AAATTACCATTGGCATAACGTCGATAATCGTATTTAC 5' 3' If the bottom strand of the DNA is the template strand, what will be the mRNA sequence and the amino acid sequence that are present in the protein? Copyright © 2010 Pearson Education, Inc.arrow_forwardPlace the steps necessary to perform RNA-Seq in the correct order. Drag the text blocks below into their correct order. Reset MAAAAAAAAAKK MAAAAAAAAAAM Compare sequences to known genome sequence. Create cDNA using reverse transcription with primers complementary to linkers. Attach linkers to the ends of the RNAs. Perform next-generation DNA sequencing. Isolate RNA from cells or tissues of interest. Fragment the RNAs.arrow_forward
- How will you know if the bacterial cells were transformed during the lab? notes are attached belowarrow_forwardHi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?arrow_forwardWatch the following video called "Human Genome Project Video" (https://fod.infobase.com/OnDemandEmbed.aspx?lti=1&token=30037&wID=97629&loid=0&w=400&h=300) then answer the following question in one paragraph each with evidence from the film to support your answers. 5) Answer in one paragraph and using the video provided to answer the following: There are companies now allowing people to clone their deceased pets. How do you feel about this? What are some good points and bad points to this service provided by some companies in your mind? 6) Answer in one paragraph and using the video provided to answer the following: There is rumor that humans are being cloned in other areas of the world. What ethical considerations can you think of that could be a problem with this type of medical experimentation? What is your opinion?arrow_forward
- Why is it important to label plates on the bottom rather than the lid? notes are attached below for further informationarrow_forwardThe following data shows bisulfite sequencing results for a small region of the genome. How many methylated C's are in the gene? Reference sequence: GAGACCTCG Bisulfite sequencing: GAGACCTTGarrow_forwardwhat is the main purpose of performing the bioinformatics analysis of 16s rRNA genes lab?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license