Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780321962751
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 18.3, Problem 2CC
Summary Introduction
To describe:
The information given on the website: https://gold.jgpi-psf.org/statistics and also to give percent of bacterial genome projects that have medical relevance.
Introduction:
The genome online database (GOLD) is a website of Joint Genome Institute that gives information about genome sequencing projects.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Based on the images attached, what does the similarity in the sequences tell you about the ermB gene found in these bacteria? Would we expect high or low sequence similarity when considering the possibility of horizontal gene transfer?
The following DNA sequences were used to generate a contig from a genome sequencing project.
ttcagattttccccg
gctaaagctccgaa
gccattaacgcc
tttagcatactacggcgtta
aaaaccggggaaaat
tccgaatcggtcattcaga
How long is the fully assembled contig?
Please answer the following questions using numbers and not text. For example, if you think the answer is 24, write 24 and not twenty-four. If you think the answer is 24 ATP, write only the number 24.
As a microbiology technician, your job is to characterize a novel bacterial strain isolated from insects. Phenotypically, you have discovered that the new bacterial strain can grow in the presence or absence of oxygen. After genome sequencing and biochemical characterization, you know that your new organism is capable of making all of the enzymes necessary for glycolysis and the TCA cycle, and that it has an electron transport chain.
Answer the following questions based on the growth of your organism on minimal media plates containing only acetate as a carbon and energy source. Acetate is transported across the membrane at the cost of 3 ATP per molecule.
Each question should be answered based on the metabolism of one molecule of acetate. If you come up with a negative value, indicate an…
Chapter 18 Solutions
Campbell Biology in Focus (2nd Edition)
Ch. 18.1 - Prob. 1CCCh. 18.2 - Prob. 1CCCh. 18.2 - Explain the advantage of the systems biology...Ch. 18.2 - Prob. 3CCCh. 18.3 - The best estimate is that the human genome...Ch. 18.3 - Prob. 2CCCh. 18.3 - Prob. 3CCCh. 18.4 - Discuss the characteristics of mammalian genomes...Ch. 18.4 - Which of the three mechanisms described in Figures...Ch. 18.4 - Prob. 3CC
Ch. 18.5 - Describe three examples of errors in cellular...Ch. 18.5 - Prob. 2CCCh. 18.5 - Prob. 3CCCh. 18.6 - Would you expect the genome of the macaque (a...Ch. 18.6 - Prob. 2CCCh. 18 - Prob. 1TYUCh. 18 - Prob. 2TYUCh. 18 - Two eukaryotic proteins have one domain in common...Ch. 18 - SCIENTIFIC INQUIRY The scientists mapping human...Ch. 18 - FOCUS ON EVOLUTION Genes important in the...Ch. 18 - FOCUS ON INFORMATION The continuity of life is...Ch. 18 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- From the results of your BLAST search you can link to the GENE entry for one of your top hits. This link is located under the “Related Information” heading at the right hand side of each displayed alignment (i.e. scroll down to the“Alignments” section). Q1: How many exons and introns are annotated for this gene? Q2: What is the function of the encoded protein?arrow_forwardWhat exactly is the purpose of the programme Finch TV? Examining the results of sequencing of the next generation It is necessary to use the.bam file extension in order to access sequencing files. For sanger sequencing files, the.ab1 file extension is required in order to open them. It is possible to open NGS files by using the.ab1 file extension.arrow_forwardYou are screen sharing Here is part of a gene: 5' TTTAATGGTAACCGTATTGCAGCTATTAGCATAAATG 3' AAATTACCATTGGCATAACGTCGATAATCGTATTTAC 5' 3' If the bottom strand of the DNA is the template strand, what will be the mRNA sequence and the amino acid sequence that are present in the protein? Copyright © 2010 Pearson Education, Inc.arrow_forward
- Place the steps necessary to perform RNA-Seq in the correct order. Drag the text blocks below into their correct order. Reset MAAAAAAAAAKK MAAAAAAAAAAM Compare sequences to known genome sequence. Create cDNA using reverse transcription with primers complementary to linkers. Attach linkers to the ends of the RNAs. Perform next-generation DNA sequencing. Isolate RNA from cells or tissues of interest. Fragment the RNAs.arrow_forwardIhsan is a biologist working with the genetics of a psychrophilic bacterium. He cloned an antifreeze gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Ihsan finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardWhich BLAST program should we use in this case? (HINT, what type of sequence are you provided with?)arrow_forward
- The following data shows bisulfite sequencing results for a small region of the genome. How many methylated C's are in the gene? Reference sequence: GAGACCTCG Bisulfite sequencing: GAGACCTTGarrow_forwardJackson Wang is a biologist working with the genetics of a thermophilic bacterium. He cloned a heat shock gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Jackson finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardwhat is the main purpose of performing the bioinformatics analysis of 16s rRNA genes lab?arrow_forward
- Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU Socond letter Key: Ala = Alanine (A) Arg Arginine (R) Asn = UUU } UAU Tyr UGU UGC Cys UGA STOP UGG Trp UCU UCC UUC Phe Ser Asparagine (N) Asp = Aspartate (D) Cys Cysteine (C) Gin = Glutamine (Q) Glu = Glutamate (E) Gly = Glycine (G) His = Histidine (H) le = Isoleucine (1) Leucine (L) Lys Lysine (K) Met = Methionine (M) Phe = Phenylalanine (F) Pro Proline (P) Ser = Serine (S) Thr Threonine (T) Trp Tryptophan (W) Tyr Tyrosine (Y) - Valine (V) UCA UCG UAA STOP UAG STOP UUA Leu UUG S CCU CC CGU CUU CUC His CGC Arg Leu Pro CAA Gin CGA CCA CCG CUA CUG CGG Leu = AGU AUU AUC } lle AUA ACU ACC ACA Ser AAC…arrow_forwardAs the leading scientist in a biomedical science laboratory, it is a requirement to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the C01 gene of 750bp. 2.1. They observe no band appearing on an agarose gel. What would be your conclusion? 2.2. They observe three bands of different sizes that resemble a smear on the gel. Advice 2.3. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their condusion? Explain. 2.4. Explain how PCR can be used to detect infectious agents in diagnoses of diseases.arrow_forwardYou need to complete the following steps for an experiment. Explain whether an acrylamide gel or an agarose gel is more appropriate to use for the following experiments. Purifying tRNA from total RNA Isolating a vector insert for cloning Analyzing PCR productsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license