The reason behind the production of antibiotics by Streptomyces that target other bacteria. Introduction: A genus ofÂ Gram-positive bacteriaÂ is Streptomyces that inhabits different environments. It has a filamentous form that shows similarity to fungi . A layer ofÂ hyphaeÂ is formed that differentiates into a chain ofÂ spores. Streptomyces produces secondary metabolites that are bioactive and act as antibiotics.

Question

Want to see the full answer?

Answer 1

Question

Chapter 18.3, Problem 1TQ

Summary Introduction

To review:

The reason behind the production of antibiotics by Streptomyces that target other bacteria.

Introduction:

A genus ofÂ Gram-positive bacteriaÂ is Streptomyces that inhabits different environments. It has a filamentous form that shows similarity to fungi. A layer ofÂ hyphaeÂ is formed that differentiates into a chain ofÂ spores. Streptomyces produces secondary metabolites that are bioactive and act as antibiotics.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Question

Chapter 18.3, Problem 1TQ

Summary Introduction

To review:

The reason behind the production of antibiotics by Streptomyces that target other bacteria.

Introduction:

A genus ofÂ Gram-positive bacteriaÂ is Streptomyces that inhabits different environments. It has a filamentous form that shows similarity to fungi. A layer ofÂ hyphaeÂ is formed that differentiates into a chain ofÂ spores. Streptomyces produces secondary metabolites that are bioactive and act as antibiotics.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 18.3, Problem 1TQ

Summary Introduction

To review:

The reason behind the production of antibiotics by Streptomyces that target other bacteria.

Introduction:

A genus ofÂ Gram-positive bacteriaÂ is Streptomyces that inhabits different environments. It has a filamentous form that shows similarity to fungi. A layer ofÂ hyphaeÂ is formed that differentiates into a chain ofÂ spores. Streptomyces produces secondary metabolites that are bioactive and act as antibiotics.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 18.3, Problem 1TQ

Summary Introduction

To review:

The reason behind the production of antibiotics by Streptomyces that target other bacteria.

Introduction:

A genus ofÂ Gram-positive bacteriaÂ is Streptomyces that inhabits different environments. It has a filamentous form that shows similarity to fungi. A layer ofÂ hyphaeÂ is formed that differentiates into a chain ofÂ spores. Streptomyces produces secondary metabolites that are bioactive and act as antibiotics.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 18.3, Problem 1TQ

Summary Introduction

To review:

The reason behind the production of antibiotics by Streptomyces that target other bacteria.

Introduction:

A genus ofÂ Gram-positive bacteriaÂ is Streptomyces that inhabits different environments. It has a filamentous form that shows similarity to fungi. A layer ofÂ hyphaeÂ is formed that differentiates into a chain ofÂ spores. Streptomyces produces secondary metabolites that are bioactive and act as antibiotics.

Answer 6

Chapter 18.3, Problem 1TQ

Summary Introduction

To review:

The reason behind the production of antibiotics by Streptomyces that target other bacteria.

Introduction:

A genus ofÂ Gram-positive bacteriaÂ is Streptomyces that inhabits different environments. It has a filamentous form that shows similarity to fungi. A layer ofÂ hyphaeÂ is formed that differentiates into a chain ofÂ spores. Streptomyces produces secondary metabolites that are bioactive and act as antibiotics.

Answer 7

Chapter 18.3, Problem 1TQ

Summary Introduction

To review:

The reason behind the production of antibiotics by Streptomyces that target other bacteria.

Introduction:

A genus ofÂ Gram-positive bacteriaÂ is Streptomyces that inhabits different environments. It has a filamentous form that shows similarity to fungi. A layer ofÂ hyphaeÂ is formed that differentiates into a chain ofÂ spores. Streptomyces produces secondary metabolites that are bioactive and act as antibiotics.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 18.1 - Prob. 1TQ Ch. 18.1 - Prob. 2TQ Ch. 18.1 - Prob. 3TQ Ch. 18.2 - Prob. 1TQ Ch. 18.2 - Prob. 2TQ Ch. 18.3 - Prob. 1TQ Ch. 18.4 - Prob. 1TQ Ch. 18.4 - Prob. 2TQ Ch. 18.4 - Prob. 3TQ Ch. 18.4 - Prob. 4TQ

Solution Summary: The author explains Streptomyces produces antibiotics to target other bacteria. They are obligate aerobes and generate dispersible spores.

Concept explainers

Videos

Want to see the full answer?

Chapter 18 Solutions