HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
19th Edition
ISBN: 9780135672990
Author: AMERMAN
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 18.2, Problem 5QC
Summary Introduction
To review:
The way the diameter of the vessel affects the peripheral resistance.
Introduction:
Blood pressure is an important physiological aspect of a healthy body. It is the outward pressure that is exerted by the blood on the outside walls of blood vessels. Blood pressure varies at different pats in the vasculature system as the blood circulates through the body. It is regulated by many factors, one of them being resistance or peripheral resistance.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 18 Solutions
HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
Ch. 18.1 - Define the three types of blood vessels in the...Ch. 18.1 - Prob. 2QCCh. 18.1 - Prob. 3QCCh. 18.1 - Prob. 4QCCh. 18.1 - Prob. 5QCCh. 18.1 - 6. How do veins differ structurally and...Ch. 18.1 - Prob. 7QCCh. 18.1 - What are venous valves, and what are their...Ch. 18.1 - Prob. 9QCCh. 18.2 - Prob. 1QC
Ch. 18.2 - Prob. 2QCCh. 18.2 - Prob. 3QCCh. 18.2 - Prob. 4QCCh. 18.2 - Prob. 5QCCh. 18.2 - Prob. 6QCCh. 18.2 - 7. How does mean arterial pressure differ from...Ch. 18.2 - Prob. 8QCCh. 18.2 - Prob. 9QCCh. 18.3 - Prob. 1QCCh. 18.3 - Prob. 2QCCh. 18.3 - Prob. 3QCCh. 18.3 - Prob. 4QCCh. 18.3 - Prob. 5QCCh. 18.3 - Prob. 6QCCh. 18.3 - Prob. 7QCCh. 18.3 - 8. What is circulatory shock, and why is it...Ch. 18.4 - Describe the structure and size of a typical...Ch. 18.4 - 2. List three ways in which substances may cross...Ch. 18.4 - 3. Describe the properties of the three types of...Ch. 18.4 - 4. What is tissue perfusion?
Ch. 18.4 - Prob. 5QCCh. 18.4 - Prob. 6QCCh. 18.4 - Prob. 7QCCh. 18.4 - Prob. 8QCCh. 18.4 - Prob. 9QCCh. 18.5 - What is hydrostatic pressure? How does hydrostatic...Ch. 18.5 - 2. In which direction does the hydrostatic...Ch. 18.5 - 3. What is colloid osmotic pressure? In which...Ch. 18.5 - Prob. 4QCCh. 18.5 - Where in the capillary does net filtration take...Ch. 18.5 - Prob. 6QCCh. 18.6 - List the three branches of the aortic arch.Ch. 18.6 - Prob. 2QCCh. 18.6 - 3. What is the cerebral arterial circle, and what...Ch. 18.6 - Prob. 4QCCh. 18.6 - Which arteries supply the anterior and posterior...Ch. 18.6 - Prob. 6QCCh. 18.6 - Which artery supplies the upper limb?Ch. 18.6 - Trace the arterial supply of the upper limb from...Ch. 18.6 - 9. Which artery supplies the lower limb?
Ch. 18.6 - Trace the arterial supply of the lower limb from...Ch. 18.6 - Prob. 11QCCh. 18.7 - Where do most veins superior to the diaphragm...Ch. 18.7 - Prob. 2QCCh. 18.7 - Where are the dural sinuses located? What drains...Ch. 18.7 - How does drainage of the posterior body wall...Ch. 18.7 - 5. Which abdominal vessels drain straight into...Ch. 18.7 - Prob. 6QCCh. 18.7 - Prob. 7QCCh. 18.7 - Prob. 8QCCh. 18.7 - Prob. 9QCCh. 18.7 - Prob. 10QCCh. 18 - Prob. 1CYRCh. 18 - Locations where vessels connect via collateral...Ch. 18 - 3. The carotid sinus contains:
a....Ch. 18 - 4. Which of the following factors would increase...Ch. 18 - Which of the following would produce a decrease in...Ch. 18 - Fill in the blanks: The two pressures within the...Ch. 18 - The lowest pressure in the systemic circuit occurs...Ch. 18 - Explain the mechanisms that assist in the return...Ch. 18 - Mark the following statements as true or false. If...Ch. 18 - Prob. 10CYRCh. 18 - Capillaries consist of: a. three thin tunics. b....Ch. 18 - List three ways in which substances can cross the...Ch. 18 - Which of the following structures is the leakiest?...Ch. 18 - Prob. 14CYRCh. 18 - 15. The hydrostatic pressure gradient drives water...Ch. 18 - Prob. 16CYRCh. 18 - Match the following arteries with the correct...Ch. 18 - Which of the following is not a common pulse...Ch. 18 - 19. Which of the following vessels does not drain...Ch. 18 - Match the following veins with the correct...Ch. 18 - 1. Explain why a severed artery spurts blood,...Ch. 18 - 2. Explain why a person who is 7 feet tall is...Ch. 18 - Prob. 3CYUCh. 18 - Prob. 1AYKACh. 18 - 2. Mr. Gupta has been diagnosed with nephrotic...Ch. 18 - Predict the effects of each of the following on...Ch. 18 - Prob. 4AYKBCh. 18 - Ms. Rodgers has been diagnosed with secretion of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license