
Concept explainers
How is immune globulin different from hyperimmune globulin?

To review:
The difference between immune globulin and hyperimmune globulin.
Introduction:
The antibody, which is also called immunoglobulin, is glycoprotein having Y-shape structure. Immunoglobulin plays a very important role in immunization of an organism. Structure of antibody hastwo heavy along with two light chains in it. Antibodies are used by the immune system of the body to kill the specific pathogens, which enter in the body and helps in providing immunity to an individual. Antibody contains epitope thatacts as antigen binding site and recognizes the specific antigen.
Explanation of Solution
The difference between immune globulin and hyperimmune globulin are given in the table below:
Immune globulin | Hyperimmune globulin |
Immune globin is the IgG fraction or solution obtained from the blood plasma of many donors. Immune globulin contains various types of antibodies in it due to the variety of infections and typical medications and vaccination experienced by the donors. | Hyperimmune globulin is prepared or obtained from the serum of individuals having specific and increased amount of antibodies to certain diseases. |
Immune globulin is used to cure or treat a variety of infections because it contains various type of antibodies in it. | Hyperimmune globulin is used to treat specific infections and diseases because the antibodies present in hyperimmune globulin are very specific for the specific type of antigen. These are reactive for a particular type of antigens. |
For example, hepatitis A and measles can be cure by administrating the immune globulin in the unvaccinated people having a lower number of antibodies. | For example, protection against hepatitis B, rabies and tetanus can be provided by preparing HBIG (hepatitis B immune globulin), RIG (rabies immune globulin) and TIG (tetanus immune globulin). |
Thus, it can be concluded that immune globulin contains various types of antibodies and is obtained from the blood plasma of individual and is not specific for an antigen while hyperimmune globulin is very specific in function.
Want to see more full solutions like this?
Chapter 18 Solutions
Nester's Microbiology: A Human Perspective
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning



