Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 17.9, Problem 1MQ
Summary Introduction
Thermophiles are the organisms mostly microbes which survive in extreme heat environment at the temperature of 41oC and above upto 122oC. Acidophiles are the organisms which lives in extreme acidic environments even at the below pH level of 1. Organisms which live in both hyper temperature and acidic environment is said to be thermoacidophilic organisms ( example:Crenoarcaeota).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 17 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 17.1 - Since cells of Halobacterium require high levels...Ch. 17.1 - What benefit does bacteriorhodopsin confer on...Ch. 17.1 - Contrast the roles of bacteriorhodopsin,...Ch. 17.2 - Prob. 1MQCh. 17.2 - Prob. 2MQCh. 17.2 - Prob. 1CRCh. 17.3 - Prob. 1MQCh. 17.3 - Prob. 2MQCh. 17.3 - What two major physiological features unify...Ch. 17.4 - Prob. 1MQ
Ch. 17.4 - Prob. 2MQCh. 17.4 - Prob. 1CRCh. 17.5 - Prob. 1MQCh. 17.5 - Prob. 2MQCh. 17.5 - Prob. 1CRCh. 17.6 - Prob. 1MQCh. 17.6 - Prob. 2MQCh. 17.6 - Prob. 1CRCh. 17.7 - Prob. 1MQCh. 17.7 - Prob. 1CRCh. 17.8 - What form of energy metabolism is widespread among...Ch. 17.8 - Prob. 2MQCh. 17.8 - Prob. 1CRCh. 17.9 - Prob. 1MQCh. 17.9 - Prob. 2MQCh. 17.9 - Prob. 1CRCh. 17.10 - What can we conclude about the...Ch. 17.10 - Prob. 2MQCh. 17.10 - Prob. 1CRCh. 17.11 - Prob. 1MQCh. 17.11 - Why would it be impossible for organisms to grow...Ch. 17.11 - What organism is the current record holder for the...Ch. 17.12 - How do hyperthermophiles keep proteins and DNA...Ch. 17.12 - How are the lipids and ribosomes of...Ch. 17.12 - What is reverse DNA gyrase and why is it important...Ch. 17.13 - What phylogenetic and physiological evidence...Ch. 17.13 - Prob. 2MQCh. 17.13 - Which chemolithotrophic lifestyle seems best...Ch. 17.13 - Why might H2 metabolism have evolved as a...Ch. 17 - Using the phylogenetic tree in Figure 17.1 as a...Ch. 17 - Prob. 2AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Lifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Bacterial Infections in Humans; Author: Professor Dave Explains;https://www.youtube.com/watch?v=FeFKAl9KyMg;License: Standard Youtube License