Foundations in Microbiology
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
bartleby

Videos

Question
Book Icon
Chapter 17.4, Problem 16CYP
Summary Introduction

Introduction:

The techniques of direct and indirect immunofluorescent antibody testing involve the use of fluorescent labelled monoclonal antibodies (fluorochrome).

Blurred answer
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?

Chapter 17 Solutions

Foundations in Microbiology

Ch. 17.2 - Describe how flowcharts and comparison tables are...Ch. 17.3 - Explain the different variations on genetic...Ch. 17.3 - Describe what is involved in direct specimen...Ch. 17.3 - Prob. 6CYPCh. 17.3 - Describe the applications of PCR in identification...Ch. 17.4 - Describe the background aims of immunologic...Ch. 17.4 - Identify how antigen-antibody reactions are...Ch. 17.4 - Prob. 11ELOCh. 17.4 - Explain the basic methods behind the Western blot...Ch. 17.4 - Prob. 13ELOCh. 17.4 - What is the basis of serology and serological...Ch. 17.4 - Differentiate between specificity and sensitivity.Ch. 17.4 - Prob. 10CYPCh. 17.4 - Prob. 11CYPCh. 17.4 - Prob. 12CYPCh. 17.4 - Prob. 13CYPCh. 17.4 - Give examples of several tests that employ...Ch. 17.4 - What is meant by complement fixation? What are...Ch. 17.4 - Prob. 16CYPCh. 17.5 - Describe the concepts behind the main types of...Ch. 17.6 - Prob. 15ELOCh. 17.6 - Prob. 17CYPCh. 17.6 - Prob. 18CYPCh. 17.6 - Prob. 19CYPCh. 17.6 - Prob. 20CYPCh. 17.6 - Observing figure 17.17, indicate whether each...Ch. 17.L1 - Multiple Matching. Match each of the following...Ch. 17.L1 - Prob. 2MCQCh. 17.L1 - Prob. 3MCQCh. 17.L1 - Prob. 4MCQCh. 17.L1 - A patient with a _____ titer of antibodies to an...Ch. 17.L1 - Prob. 6MCQCh. 17.L1 - Prob. 7MCQCh. 17.L1 - An example of an in vivo serological test is a....Ch. 17.L1 - Which of the following specimens must be removed...Ch. 17.L1 - Prob. 1CSRCh. 17.L1 - Prob. 2CSRCh. 17.L1 - Prob. 3CSRCh. 17.L1 - Prob. 1WCCh. 17.L1 - Prob. 2WCCh. 17.L1 - Briefly describe the principles and give an...Ch. 17.L1 - Prob. 4WCCh. 17.L1 - Prob. 5WCCh. 17.L1 - Prob. 6WCCh. 17.L2 - Prob. 1CTCh. 17.L2 - Prob. 2CTCh. 17.L2 - Why do some tests for antibody in serum (such as...Ch. 17.L2 - Prob. 4CTCh. 17.L2 - Prob. 5CTCh. 17.L2 - Prob. 6CTCh. 17.L2 - From chapter 3, fig 3.17a (reproduced on the...Ch. 17.L2 - Prob. 2VC
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Basic Clinical Laboratory Techniques 6E
Biology
ISBN:9781133893943
Author:ESTRIDGE
Publisher:Cengage
Text book image
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Text book image
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Text book image
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
Text book image
Body Structures & Functions
Biology
ISBN:9781285695495
Author:Scott
Publisher:Cengage
Text book image
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Haematology - Red Blood Cell Life Cycle; Author: Armando Hasudungan;https://www.youtube.com/watch?v=cATQFej6oAc;License: Standard youtube license