Anatomy and Physiology
9th Edition
ISBN: 9781260256000
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 16.2, Problem 4AYLO
Definitions of pain and nociceptor
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 16 Solutions
Anatomy and Physiology
Ch. 16.1 - Not every sensory receptor is a sense organ....Ch. 16.1 - What does it mean to say sense organs are...Ch. 16.1 - Prob. 3BYGOCh. 16.1 - What is meant by the modality of a stimulus? Give...Ch. 16.1 - Three schemes of receptor classification were...Ch. 16.1 - Nociceptors are tonic rather than phasic...Ch. 16.1 - The definition of receptor and the range of...Ch. 16.1 - Prob. 2AYLOCh. 16.1 - Prob. 3AYLOCh. 16.1 - Prob. 4AYLO
Ch. 16.1 - Prob. 5AYLOCh. 16.1 - Prob. 6AYLOCh. 16.1 - Prob. 7AYLOCh. 16.2 - What stimulus modalities are detected by free...Ch. 16.2 - Prob. 8BYGOCh. 16.2 - Where do most second-order somatosensory neurons...Ch. 16.2 - Explain the phenomenon of referred pain in terms...Ch. 16.2 - Explain the roles of bradykinin, substance P, and...Ch. 16.2 - Prob. 12BYGOCh. 16.2 - Three Types of unencapsulated sensory nerve...Ch. 16.2 - Six types of encapsulated nerve endings and how...Ch. 16.2 - The main routes for somatosensory signals from the...Ch. 16.2 - Definitions of pain and nociceptorCh. 16.2 - Differences between fast pain and slow painCh. 16.2 - Differences between somatic and visceral pain, and...Ch. 16.2 - Several chemicals released by injured tissues that...Ch. 16.2 - The general three-neuron pathway typically taken...Ch. 16.2 - Pain pathways from receptors in the head to the...Ch. 16.2 - Pain pathways from the lower body to the cerebral...Ch. 16.2 - Prob. 11AYLOCh. 16.2 - Referred pain and its anatomical basisCh. 16.2 - Prob. 13AYLOCh. 16.2 - Prob. 14AYLOCh. 16.3 - Prob. 13BYGOCh. 16.3 - Prob. 14BYGOCh. 16.3 - Prob. 15BYGOCh. 16.3 - Prob. 16BYGOCh. 16.3 - Prob. 17BYGOCh. 16.3 - Prob. 1AYLOCh. 16.3 - Types, locations, and functions of lingual...Ch. 16.3 - Five primary taste sensations, and sensations...Ch. 16.3 - Prob. 4AYLOCh. 16.3 - Prob. 5AYLOCh. 16.3 - Prob. 6AYLOCh. 16.3 - How odor molecules excite olfactory cellsCh. 16.3 - Prob. 8AYLOCh. 16.3 - Prob. 9AYLOCh. 16.3 - Prob. 10AYLOCh. 16.4 - Prob. 18BYGOCh. 16.4 - Prob. 19BYGOCh. 16.4 - Prob. 20BYGOCh. 16.4 - Prob. 21BYGOCh. 16.4 - Prob. 22BYGOCh. 16.4 - Why can't we see wavelengths of 350 nm or 750 nm?Ch. 16.4 - Prob. 1AYLOCh. 16.4 - Prob. 2AYLOCh. 16.4 - Prob. 3AYLOCh. 16.4 - Prob. 4AYLOCh. 16.4 - Prob. 5AYLOCh. 16.4 - Prob. 6AYLOCh. 16.4 - The bony and membranous labyrinths of the inner...Ch. 16.4 - Prob. 8AYLOCh. 16.4 - Prob. 9AYLOCh. 16.4 - Prob. 10AYLOCh. 16.4 - Prob. 11AYLOCh. 16.4 - Prob. 12AYLOCh. 16.4 - Prob. 13AYLOCh. 16.4 - Prob. 14AYLOCh. 16.4 - The pathway from cochlear nerve to auditory...Ch. 16.4 - Prob. 16AYLOCh. 16.4 - Prob. 17AYLOCh. 16.4 - Prob. 18AYLOCh. 16.4 - Prob. 19AYLOCh. 16.4 - Prob. 20AYLOCh. 16.4 - Prob. 21AYLOCh. 16.4 - The path taken by signals in the vestibular nerve...Ch. 16.4 - Prob. 23AYLOCh. 16.5 - Prob. 24BYGOCh. 16.5 - Prob. 25BYGOCh. 16.5 - Prob. 26BYGOCh. 16.5 - Prob. 27BYGOCh. 16.5 - Prob. 28BYGOCh. 16.5 - Prob. 1AYLOCh. 16.5 - Six extrinsic eye muscles, their anatomy, the eye...Ch. 16.5 - Prob. 3AYLOCh. 16.5 - Prob. 4AYLOCh. 16.5 - Prob. 5AYLOCh. 16.5 - Prob. 6AYLOCh. 16.5 - Prob. 7AYLOCh. 16.5 - General structure of the retina: its two points of...Ch. 16.5 - Prob. 9AYLOCh. 16.5 - Prob. 10AYLOCh. 16.5 - Principles of refraction; points at which...Ch. 16.5 - The difference between enmetropia and lite near...Ch. 16.5 - Histological layers and cell types of the retina....Ch. 16.5 - The structures of rods and cones; where visual...Ch. 16.5 - Differences in rod and cone functionCh. 16.5 - Prob. 16AYLOCh. 16.5 - Prob. 17AYLOCh. 16.5 - Why a single retinal receptor system cannot...Ch. 16.5 - Difference between S, M, and L cones; how neural...Ch. 16.5 - Prob. 20AYLOCh. 16.5 - Prob. 21AYLOCh. 16.5 - Hemidecussation, where it occurs, and how it...Ch. 16.5 - Prob. 23AYLOCh. 16 - Hot and cold stimuli are detected by a. free nerve...Ch. 16 - _____is a neurotransmitter that transmits pain...Ch. 16 - Prob. 3TYRCh. 16 - Prob. 4TYRCh. 16 - Prob. 5TYRCh. 16 - Prob. 6TYRCh. 16 - Prob. 7TYRCh. 16 - Prob. 8TYRCh. 16 - The retina receives its oxygen supply from a. the...Ch. 16 - Prob. 10TYRCh. 16 - The most finely detailed vision occurs when an...Ch. 16 - Prob. 12TYRCh. 16 - Prob. 13TYRCh. 16 - Prob. 14TYRCh. 16 - Three rows of________in the cochlea have V-shaped...Ch. 16 - The ______ is a tiny bone that vibrates in the...Ch. 16 - The _____ of the midbrain receives auditory input...Ch. 16 - Prob. 18TYRCh. 16 - Olfactory neurons synapse with mitral cells and...Ch. 16 - In the phenomenon of ______, pain from the viscera...Ch. 16 - bin-Ch. 16 - decuss-Ch. 16 - hemi-Ch. 16 - lacrimo-Ch. 16 - litho-Ch. 16 - maculo-Ch. 16 - noci-Ch. 16 - scoto-Ch. 16 - -sepsisCh. 16 - Prob. 10BYMVCh. 16 - The sensory (afferent) nerve fibers for touch end...Ch. 16 - Prob. 2WWTSCh. 16 - Things we see with the left eye are perceived only...Ch. 16 - Prob. 4WWTSCh. 16 - The vitreous body occupies the posterior chamber...Ch. 16 - Prob. 6WWTSCh. 16 - Prob. 7WWTSCh. 16 - Prob. 8WWTSCh. 16 - Prob. 9WWTSCh. 16 - Prob. 10WWTSCh. 16 - The principle of neural convergence is explained...Ch. 16 - What type of cutaneous receptor enables you to...Ch. 16 - Prob. 3TYCCh. 16 - Prob. 4TYCCh. 16 - Prob. 5TYC
Additional Science Textbook Solutions
Find more solutions based on key concepts
Calculate the lattice energy of CaCl2 using a Born-Haber cycle and data from Appendices F and L and Table 7.5. ...
Chemistry & Chemical Reactivity
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
SEELEY'S ANATOMY+PHYSIOLOGY
An obese 55-year-old woman consults her physician about minor chest pains during exercise. Explain the physicia...
Biology: Life on Earth with Physiology (11th Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
HUMAN ANATOMY
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Visual Perception – How It Works; Author: simpleshow foundation;https://www.youtube.com/watch?v=DU3IiqUWGcU;License: Standard youtube license