
Introduction:
Allergies are the conditions caused by hypersensitivity of the immune system to substances that are typically harmless in the environment. Common allergens include pollen, certain type of foods, metals and other substances such as insect stings, and medications.

Answer to Problem 1MCQ
Correct answer:
Pollen is an inhalant type of allergen. Hence, option (d) is correct.
Option (d) is given as “Inhalant”.
Explanation of Solution
Justify reason for the correct statement:
The pollen is light and is produced by plants for the purpose of reproduction. These pollens are light and travel through air and get inhaled during breathing. It causes irritation in the respiratory tract.
Hence, option (d) is correct.
Justify reasons for the incorrect statements:
Option (a) is given as “contactant”.
Contact allergens enter the body through the skin and these allergens generally cause skin rashes or itching but pollen causes irritation in the respiratory tract. Hence, it is a wrong answer.
Option (b) is given as “ingestant”.
Ingestants are the food-based allergens and enter the body through food consumption. It basically consists of milk, peanuts, wheat nuts and many more. But pollen is not a consumable item. Hence, it is a wrong answer.
Option (c) is given as “Injectants”
Injectants enter the body through insect bite, drugs or serum. Hence, it is a wrong answer.
Hence, options (a), (b), and (c) are incorrect.
The pollen is a type of inhalant allergen. They enter the body while breathing and cause irritation in the respiratory tract.
Want to see more full solutions like this?
Chapter 16 Solutions
Microbiology: A Systems Approach
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

