
Mark the following statements as true or false. If a statement is false, correct it to make a true statement.
a. The cells of the nervous system communicate via action potentials, whereas the cells of the endocrine system communicate via hormones.
b. Autocrine signals affect the same cells that secrete them.
c. The pancreas, thyroid gland, and parathyroid glands secrete neurohormones.
d. Steroid hormones are hydrophilic molecules that bind to plasma membrane proteins as part of a second-messenger system.
e. The secretion of most hormones is regulated by a negative feedback system.

To review:
Whether the following statements are true or false:
a. The cells of the nervous system communicate via an action potential, whereas the cells of the endocrine system communicate via hormones.
b. Autocrine signals affect the same cells that secrete them.
c. The pancreas, the thyroid gland, and the parathyroid gland secrete neurohormones.
d. Steroid hormones are hydrophilic molecules that bind to the plasma membrane proteins as a part of the second-messenger system.
e. The secretion of most hormones isregulated by a negative feedback mechanism.
Introduction:
The endocrine system secretes chemical messengers called hormones. These hormones travel to their target cells via the bloodstream and attach to their specific receptors. The hormones then make changes to the cell’s function.
Explanation of Solution
a. The statement, “The cells of the nervous system communicate via an action potential, whereas the cells of the endocrine system communicate via hormones,” is false. The cells of the nervous system and also the endocrine system communicate via chemicals. The information is carried forward in the form of an action potential in the nervous system. However, when the information is to be sent to another cell, the neurons secrete neurotransmitters to affect the cell. Hormones are also known as chemical messengers due to their ability to communicate with other cells and bring about the expected changes.
The correct statement is “The cells of the nervous system as well as the endocrine system communicate via chemicals.”
b. The statement, “Autocrine signals affect the same cells that secrete them,” is correct. There are three ways by which the endocrine gland can communicate with the target tissues and cells. It can secrete chemicals in the blood that reach the target cells or it can secrete chemicals in the extracellular fluid (or ECF). In the case of paracrine glands, the chemicals are secreted in the ECF that target the local cells. In the case of autocrine glands, the chemicals are secreted in the ECF, but they act on the same cells that secreted them.
c. The statement, “The pancreas, the thyroid gland, and the parathyroid gland secrete neurohormones,” is false. There are a group of organs, known as the secondary endocrine organs, which are not a part of the endocrine system. Neuroendocrine organs are secondary endocrine organs that secrete neurohormones.
The hypothalamus, the pineal glans and the adrenal medulla are such organs as they are made up of nerve cells, but they secrete hormones; hence, they are called neurohormones. The correct statement is “The pancreas, the thyroid gland, and the parathyroid gland do not secrete neurohormones.”
d. The statement, “Steroid hormones are hydrophilic molecules that bind to the plasma membrane proteins as a part of the second-messenger system,” is false. Steroid hormones are cholesterol-derived, and hence, are hydrophobic in nature. Due to their lipid-based nature, they can cross the plasma membrane and bind to the receptors, even if they present in the cytosol or the nucleus. Aminoacid–based hormones are protein-derived and hydrophilic in nature. They cannot cross the lipid-based plasma membrane. So, their receptors are always situated on the plasma membrane. The correct statement is “Aminoacid hormones are hydrophilic molecules that bind to the plasma membrane proteins as a part of the second-messenger system.”
e. The statement “The secretion of most hormones is regulated by a negative feedback mechanism” is correct. When the receptors in the body detect a change, they send this information to the control center, which is an endocrine gland. This gland responds by secreting hormones to control the situation. The hormone reaches the target cell and shows the desired outcome. When the desired outcome is reached, the feedback sent to the control center decreases the hormone secretion.
Thus, it can be concluded that statements (b) and (e) are true as per the reasons provided, and statements (a), (c), and (d) are false.
Want to see more full solutions like this?
Chapter 16 Solutions
Human Anatomy & Physiology
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning




