
Enteric bacteria, lactic acid bacteria, and propionic acid bacteria have distinctive

To describe:
The metabolic characteristics of enteric bacteria, propionic acid bacteria, and lactic acid bacteria, name a genus that belongs to each group, and indicate by what means these organisms can be distinguished.
Concept introduction:
The order Lactobacillales comprised of fermentative organisms such as lactic acid bacteria. The lactic acid bacteria generate lactic acid as the end-product after the fermentation process. Enteric acid bacteria are bacteria usually resides in the intestine of humans and animals. The enteric bacteria play an important role in digestion of their hosts. The propionic acid bacteria reside in the sweat glands of the human and it is also present in the stomach of the ruminants.
Explanation of Solution
Enteric bacteria, for example species of Escherichia are facultative anaerobes. They inhabit the gastrointestinal tract of humans and warm-blooded animals, where they characteristically grow chemoorganotrophically by means of fermentation. They live in a wide range of substrates. Under anaerobic conditions they use mixed-acid fermentation generating succinate, acetate, ethanol, and lactate.
Lactic acid bacteria, for example species of Lactobacillus are aerotolerant, anaerobes. During fermentative metabolism, they yield lactate as the major product, in which energy is produced by substrate-level phosphorylation. The lactic acid bacteria have restricted biosynthetic abilities and characteristically have complex nutritional necessities such as amino acids, vitamins, purines, and pyrimidines.
Propionic acid bacteria are fermentative bacteria, for example species of Propionibacterium. They commonly establish in the sweat glands of humans and the stomachs of ruminants. The propionic acid bacteria generate acetic acid, propionic acid, and Co2 as products of anaerobic metabolism. Lactate is the major substrate for propionic acid bacteria, which is already a fermentation product. Therefore, propionic acid bacteria carry out secondary fermentation by fermenting the previous product of fermentation.
Want to see more full solutions like this?
Chapter 16 Solutions
Brock Biology of Microorganisms (15th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning


