Concept explainers
Videos
What does it mean wheti we say that the two DNA strands in the double helix are antiparallel? What would an end of the double helix look like if the strands were parallel?
To explain: The meaning of the statement “the two strands in the double helix DNA are antiparallel”.
Introduction: DNA is a double-stranded molecule that consists of two strands of nucleotides. The bases in one strand are complementary to the bases on the other strand. During DNA replication, the two strands of parent DNA molecule separate. The parent strands act as templates along which the DNA polymerases add up the complementary base pairs in the context of base-pairing rules.
Explanation of Solution
A deoxyribonucleic acid (DNA) molecule consists of two polynucleotide chains that associate as a double helix structure. The polarity in the DNA chain is referred to as 5ʹ end and the other as 3ʹ end. One end of DNA consists of a phosphate attached to a 5ʹ deoxyribose carbon (5ʹ end), and the other end has a hydroxyl group that is attached to a 3ʹ deoxyribose carbon (3ʹ end). The nucleotides are linked by phosphodiester bonds through 5ʹ-P of one sugar and 3ʹ-OH group of the next sugar. In a double-stranded DNA, one strand is “complemented” by the other strand. If one DNA strand runs in the 5ʹ→3ʹ direction, its complementary strand would run in the 3ʹ→5ʹ direction. Thus, the two strands are antiparallel to each other.
To determine: The ends of a double helix DNA if the two DNA strands in the double helix were parallel.
Introduction: DNA or deoxyribonucleic acid carries hereditary information from one generation to another. DNA replication is a process that takes place in every biological cell. It involves the coping and producing of two identical copies of a cell from their parent DNA molecule.
Explanation of Solution
If two DNA strands run in parallel directions, they would run in the same direction, that is, they would both run in the 5′→3′ direction. In such a condition, in the same side, an end of the DNA molecule would have two 5′ ends and two 3′ ends.
Want to see more full solutions like this?
Chapter 16 Solutions
Campbell Biology (10th Edition)
Additional Science Textbook Solutions
Applications and Investigations in Earth Science (9th Edition)
College Physics: A Strategic Approach (3rd Edition)
Laboratory Manual For Human Anatomy & Physiology
SEELEY'S ANATOMY+PHYSIOLOGY
Biology: Life on Earth with Physiology (11th Edition)
Chemistry: A Molecular Approach (4th Edition)
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forwardWhich of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.arrow_forwardWhat are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-Tarrow_forward
- Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’arrow_forwardIf the sequence of bases on the one of the strand of a DNA molecule 5’ATTGCGGA - 3’ What is the complimentary strand would read ?arrow_forwardThe two strands for the helix-shaped DNA molecule are heldtogether by electrostatic forces as shown in class. Due to electron sharing, themagnitude of the net average charge on the H and N atoms, each, is 0.2e. Thenet average charge on the C and O atoms, each, is 0.4e. The distance betweenany two adjacent atoms on the same molecule is 0.1nm. Since electric fieldsdecrease as an inverse square law, they die off quickly with distance. So, theonly fields that really contribute to any given bond are due to the 3 atomsalong the red dotted line in the class diagram (two atoms on one'molecule andone atom on the other molecule).Calculate the electric fields and net force between a thymineand an adenine pair.=Calculate the electric fields and net force between a cytosineand a guanine pair.nConsider the OHN bond in the AT nucleotide. Can theelectric field be zero anywhere along the axis of this bond? If not,explain why not. If so, find where the electric field is zero.arrow_forward
- In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in DNA/RNA as well? Briefly explain. What does Chargaff’s rules mean? Who proposed DNA was a double helix? In what decade? If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? When DNA replicates, how is it able to “unwind” its double helix?arrow_forwardWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATarrow_forward(üij If one of the strands of DNA has the following sequence of bases running in the 5' →3' direction 5'-G-G-A-C-A-A-T-C-T-G-C-3' 3'e c 4 GT TAGA C GS vhat base is 'closes: to 5' end in the compiementary strand?arrow_forward
- Using your own words and including the phrases “5’ to 3’” and “3’ to 5’” explain how a double helix of DNA is antiparallel.arrow_forwardGiven the following sequence for one strand of a double-stranded oligonucleotide: 5'ACCGTAAGGCTTTAG3' (a) Write the sequence for the complementary DNA strand. (b) Suppose you knew that the strand shown above had phosphate on both ends. Using an accepted nomenclature, write the sequence so as to show this. (c) Write the sequence of the RNA complementary to the strand shown above.arrow_forwardAssume this spring represents a DNA Double Helix. Does it represent a Right Handed Helix or a Left Handed Helix and is it consisted with the helical structure of actual DNA? meroarrow_forward
