Biology (MindTap Course List)
Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 15.1, Problem 1C
Summary Introduction

To write: The sequence and the position of the cut for the complementary strand of the DNA sequence Biology (MindTap Course List), Chapter 15.1, Problem 1C .

Concept introduction: DNA is a double-stranded molecule consisting of two strands of nucleotides. The bases in one strand are complementary to the bases on the other strand. Restriction enzymes recognize their specific target sequence and excise DNA at that sequence or adjacent to it.

Blurred answer
Students have asked these similar questions
After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt.  In all cases each end is left with a 3' OH and a 5' phosphate.  All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present.   In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G      3' -----CTTAA  5' GTGCA^C means that the end will be:   -----GTGCA  3' -----C      5'     Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?   AccI GT^CGAC BamHI G^GATCC     ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGA
Induce a silent mutation in the template strand. Illustrate the output.
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above

Chapter 15 Solutions

Biology (MindTap Course List)

Ch. 15.2 - Prob. 8LOCh. 15.2 - Prob. 1CCh. 15.2 - Prob. 2CCh. 15.2 - Prob. 3CCh. 15.3 - Prob. 9LOCh. 15.3 - Prob. 10LOCh. 15.3 - Discuss how qPCR, DNA microarrays (DNA chips), and...Ch. 15.3 - Explain how you would compare the expression of a...Ch. 15.3 - Prob. 2CCh. 15.4 - Describe how genome-wide association studies have...Ch. 15.4 - Explain how targeted gene silencing and knockout...Ch. 15.4 - Prob. 1CCh. 15.5 - Describe at least one important application of DNA...Ch. 15.5 - Prob. 1CCh. 15.5 - What are short tandem repeats (STRs), and why are...Ch. 15.5 - Why do gene targeting and mutagenesis screening in...Ch. 15.6 - Prob. 15LOCh. 15.6 - Prob. 16LOCh. 15.6 - Prob. 1CCh. 15.6 - Prob. 2CCh. 15.7 - Describe at least two safety issue associated with...Ch. 15.7 - What are some of the environment concerns...Ch. 15 - A plasmid (a) can be used as a DNA vector (b) is a...Ch. 15 - DNA molecules with complementary sticky ends...Ch. 15 - Prob. 3TYUCh. 15 - Which technique rapidly replicated specific DNA...Ch. 15 - Prob. 5TYUCh. 15 - A cDNA clone contains (a) introns (b) exons (c)...Ch. 15 - Prob. 7TYUCh. 15 - Gel electrophoresis separates nucleic acids on the...Ch. 15 - A CRISPR locus in a bacterium contains (a) short...Ch. 15 - DNA molecular with complementary sticky ends...Ch. 15 - These highly polymorphic molecular markers are...Ch. 15 - Prob. 12TYUCh. 15 - Prob. 13TYUCh. 15 - Prob. 14TYUCh. 15 - EVOLUTION LINK DNA technology, such as the...Ch. 15 - SCIENCE, TECHNOLOGY, AND SOCIETY What are some...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License