BIOLOGY
BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 15, Problem 3S

Describe how each of the following mutations will affect the final protein product (protein begins with start codon). Name the type of mutation.

Original template strand:

3′ – CGTTACCCGACCGTACGATTAGG–5′

3′ – CGTTACCCGAGCCGTAACGATTAGG –5′

3′ – CGTTACCCGATCCGTACGATTAGG –5′

3′ – CGTTACCCGAGCCGTTCGATTAGG –5′

Blurred answer
Students have asked these similar questions
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene.                123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3   a. Write the template DNA (complementary strand) sequence for the wild type gene above  b. Write the DNA sequence of the mutant gene (Both DNA strands)  c. Write the sequence of mRNA produced from the mutant gene  d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
Consider the following DNA template:   5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’   If the bottom DNA  strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation.   Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA?  The top strand is the template strand, the bottom strand is the coding strand.     5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’   3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'

Chapter 15 Solutions

BIOLOGY

Ch. 15.4 - Prob. 2LOCh. 15.4 - Explain the differences between bacterial and...Ch. 15.5 - Prob. 1LOCh. 15.5 - Prob. 2LOCh. 15.5 - Prob. 3LOCh. 15.6 - Explain why the tRNA charging reaction is critical...Ch. 15.6 - Prob. 2LOCh. 15.7 - Prob. 1LOCh. 15.7 - Prob. 2LOCh. 15.7 - Compare translation on the RER and in the...Ch. 15.9 - Prob. 1LOCh. 15.9 - Explain the nature of triplet repeat expansion.Ch. 15.9 - Prob. 3LOCh. 15 - Prob. 1DACh. 15 - Prob. 2DACh. 15 - Prob. 1IQCh. 15 - Prob. 2IQCh. 15 - Prob. 3IQCh. 15 - The experiments with nutritional mutants in...Ch. 15 - What is the central dogma of molecular biology? a....Ch. 15 - In the genetic code, one codon a. consists of...Ch. 15 - Eukaryotic transcription differs from prokaryotic...Ch. 15 - An anticodon would be found on which of the...Ch. 15 - RNA polymerase binds to a ________ to initiate...Ch. 15 - During translation, the codon in mRNA is actually...Ch. 15 - You have mutants that all affect the same...Ch. 15 - The splicing process a. occurs in prokaryotes. b....Ch. 15 - The enzyme that forms peptide bonds is called...Ch. 15 - In comparing gene expression in prokaryotes and...Ch. 15 - The codon CCA could be mutated to produce a. a...Ch. 15 - An inversion will a. necessarily cause a mutant...Ch. 15 - What is the relationship between mutations and...Ch. 15 - Prob. 1SCh. 15 - Frameshift mutations often result in truncated...Ch. 15 - Describe how each of the following mutations will...Ch. 15 - There are a number of features that are unique 10...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY