BIOLOGY
BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 15, Problem 1S

a.

Summary Introduction

To predict:

The sequence of the mRNA .

Using the template strand of the DNA with the sequence

3'CGTTACCCGAGCCGTACGATTAGG5'

Introduction:

The sequence of the m-RNA, is copied from the DNA by the process transcription and the amino acid sequence from the m-RNA is formed by the process of translation. Both of these processes lead to gene expression in eukaryotes.

b.

Summary Introduction

To predict:

The amino acid sequence of the protein.

Using the template strand of the DNA with the sequence

3'CGTTACCCGAGCCGTACGATTAGG5'

Introduction:

The sequence of the m-RNA, is copied from the DNA by the process transcription and the amino acid sequence from the m-RNA is formed by the process of translation. Both of these processes lead to gene expression in eukaryotes.

Blurred answer
Students have asked these similar questions
9. Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure below. Use the information below to determine how much ATP will be produced from the glycerol part of the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your total number of ATP produced per lipid. Assume no other carbon source is available. 18 carbons fatty acids 12 carbons 9 glycerol A. Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration. glycerol glycerol-3- phosphate…
Normal dive (for diving humans) normal breathing dive normal breathing Oz level CO2 level urgent need to breathe Oz blackout zone high CO2 triggers breathing 6. This diagram shows rates of oxygen depletion and carbon dioxide accumulation in the blood in relation to the levels needed to maintain consciousness and trigger the urgent need to breathe in diving humans. How might the location and slope of the O₂ line differ for diving marine mammals such as whales and dolphins? • How might the location and slope of the CO₂ line differ for diving marine mammals such as whales and dolphins? • • Draw in predicted lines for O2 and CO2, based on your reasoning above. How might the location of the Urgent Need to Breathe line and the O2 Blackout Zone line differ for diving marine mammals? What physiological mechanisms account for each of these differences, resulting in the ability of marine mammals to stay submerged for long periods of time?
foraging/diet type teeth tongue stomach intestines cecum Insectivory numerous, spiky, incisors procumbentExample: moleExample: shrew -- simple short mostly lacking Myrmecophagy absent or reduced in numbers, peg-likeExample: tamandua anteater extremely long simple, often roughened short small or lacking Terrestrial carnivory sharp incisors; long, conical canines; often carnassial cheek teeth; may have crushing molarsExample: dog -- simple short small Aquatic carnivory homodont, spiky, numerousExample: common dolphin -- simple or multichambered (cetaceans only) variable small or absent Sanguinivory very sharp upper incisors; reduced cheek teethExample: vampire bat grooved tubular, highly extensible long small or lacking Herbivory (except nectivores) incisors robust or absent; canines reduced or absent; diastema; cheek teeth enlarged with complex occlusal surfacesExample: beaver -- simple (hindgut fermenters) or multichambered (ruminants) long large Filter feeding none…

Chapter 15 Solutions

BIOLOGY

Ch. 15.4 - Prob. 2LOCh. 15.4 - Explain the differences between bacterial and...Ch. 15.5 - Prob. 1LOCh. 15.5 - Prob. 2LOCh. 15.5 - Prob. 3LOCh. 15.6 - Explain why the tRNA charging reaction is critical...Ch. 15.6 - Prob. 2LOCh. 15.7 - Prob. 1LOCh. 15.7 - Prob. 2LOCh. 15.7 - Compare translation on the RER and in the...Ch. 15.9 - Prob. 1LOCh. 15.9 - Explain the nature of triplet repeat expansion.Ch. 15.9 - Prob. 3LOCh. 15 - Prob. 1DACh. 15 - Prob. 2DACh. 15 - Prob. 1IQCh. 15 - Prob. 2IQCh. 15 - Prob. 3IQCh. 15 - The experiments with nutritional mutants in...Ch. 15 - What is the central dogma of molecular biology? a....Ch. 15 - In the genetic code, one codon a. consists of...Ch. 15 - Eukaryotic transcription differs from prokaryotic...Ch. 15 - An anticodon would be found on which of the...Ch. 15 - RNA polymerase binds to a ________ to initiate...Ch. 15 - During translation, the codon in mRNA is actually...Ch. 15 - You have mutants that all affect the same...Ch. 15 - The splicing process a. occurs in prokaryotes. b....Ch. 15 - The enzyme that forms peptide bonds is called...Ch. 15 - In comparing gene expression in prokaryotes and...Ch. 15 - The codon CCA could be mutated to produce a. a...Ch. 15 - An inversion will a. necessarily cause a mutant...Ch. 15 - What is the relationship between mutations and...Ch. 15 - Prob. 1SCh. 15 - Frameshift mutations often result in truncated...Ch. 15 - Describe how each of the following mutations will...Ch. 15 - There are a number of features that are unique 10...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY