1 SEM ACC W/RAVEN CARDED
12th Edition
ISBN: 9781265486297
Author: Raven
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 15, Problem 2IQ
Summary Introduction
To describe: Why the genetic code is believed to be nearly universal.
Introduction: To convert genotype to
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In your own words,
What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the code’s Universality? Degeneracy?
What is the concept of universality of the genetic code? What are the exceptions to this universality?
The more similar your genetic code is to another individual... *
The more likely you are to meet.
The more closely related you are.
They more distantly related you are.
The less likely you are to meet.
Sign out
US
tab
shift
Chapter 15 Solutions
1 SEM ACC W/RAVEN CARDED
Ch. 15.1 - Prob. 1LOCh. 15.1 - Prob. 2LOCh. 15.1 - List the roles played by RNA in gene expression.Ch. 15.2 - Prob. 1LOCh. 15.2 - Describe the characteristics of the genetic code.Ch. 15.2 - Prob. 3LOCh. 15.3 - Prob. 1LOCh. 15.3 - Differentiate among initiation, elongation, and...Ch. 15.3 - Prob. 3LOCh. 15.4 - Prob. 1LO
Ch. 15.4 - Prob. 2LOCh. 15.4 - Explain the differences between bacterial and...Ch. 15.5 - Prob. 1LOCh. 15.5 - Prob. 2LOCh. 15.5 - Prob. 3LOCh. 15.6 - Explain why the tRNA charging reaction is critical...Ch. 15.6 - Prob. 2LOCh. 15.7 - Prob. 1LOCh. 15.7 - Prob. 2LOCh. 15.7 - Compare translation on the RER and in the...Ch. 15.9 - Prob. 1LOCh. 15.9 - Explain the nature of triplet repeat expansion.Ch. 15.9 - Prob. 3LOCh. 15 - Prob. 1DACh. 15 - Prob. 2DACh. 15 - Prob. 1IQCh. 15 - Prob. 2IQCh. 15 - Prob. 3IQCh. 15 - The experiments with nutritional mutants in...Ch. 15 - What is the central dogma of molecular biology? a....Ch. 15 - In the genetic code, one codon a. consists of...Ch. 15 - Eukaryotic transcription differs from prokaryotic...Ch. 15 - An anticodon would be found on which of the...Ch. 15 - RNA polymerase binds to a ________ to initiate...Ch. 15 - During translation, the codon in mRNA is actually...Ch. 15 - You have mutants that all affect the same...Ch. 15 - The splicing process a. occurs in prokaryotes. b....Ch. 15 - The enzyme that forms peptide bonds is called...Ch. 15 - In comparing gene expression in prokaryotes and...Ch. 15 - The codon CCA could be mutated to produce a. a...Ch. 15 - An inversion will a. necessarily cause a mutant...Ch. 15 - What is the relationship between mutations and...Ch. 15 - Prob. 1SCh. 15 - Frameshift mutations often result in truncated...Ch. 15 - Describe how each of the following mutations will...Ch. 15 - There are a number of features that are unique 10...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardIf the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fivearrow_forwardBelow is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forward
- Why can the genetic code be qualified as a “degenerate code”?arrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forwardThe human genome sequence encodes many more mRNA transcripts than there are genes. Why isn’t the number the same?arrow_forward
- Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…arrow_forwardBased on the work presented in Boch et al., 2009 Science, choose all of the DNA sequences that can be bound by a TAL effector with the following repeat structure: NG-HD-HD-NN-NG-NI-NS-NI-HD-NG O T-C-C-A-T-A-A-A-C-T OT-C-C-G-T-A-A-A-C-T O T-C-C-A-T-A-G-A-C-T OT-G-G-A-T-A-T-C-T-A T-C-C-G-T-A-C-A-C-T O T-C-G-C-T-A-C-C-T-Aarrow_forwardThe genetic code is unambiguous primarily because of choose your answer. The genetic code is degenerate primarily because of choose your answer...arrow_forward
- Crick's Central Dogma states that there is a unidirectional flow of genetic information DNA ---> RNA -----> Protein Explain why this may not always be the case. (Describe a scenario in which movement may occur in the opposite direction).arrow_forwardIf the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = argininearrow_forward. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY