
Concept explainers
Introduction:
In the spinal cord, there are many tracts and systems that carry information to and from the brain. Among these tracts and systems, some contain sensory neuron and some contain motor neuron. The gracile nucleus is the part of a spinal cord posterior column and is located in the medulla oblongata. This nucleus is involved in the sensation of fine touch, pressure, and proprioception associated with a lower region of the body.
The neurons found in the spinal cord are first, second, and third order neurons. The first order neuron transfers the information to the central nervous system. The second order neuron synapses on the first order neuron. In the thalamus, this neuron synapses on third order neuron. The brain’s right side obtains the information from the body’s left side, while the information from the right side of the body is received by the brain’s left side. This occurs because the axon of the first order and the second order neurons cross the central nervous system’s (CNS’s) opposite side.

Want to see the full answer?
Check out a sample textbook solution
Chapter 15 Solutions
HUMAN ANATOMY PACKAGE 2015
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengagePrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College


