
Human Physiology: An Integrated Approach (7th Edition)
7th Edition
ISBN: 9780321981226
Author: Dee Unglaub Silverthorn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15, Problem 11CC
Summary Introduction
To determine: The ions and their directions that flow through stretch-sensitive ion channels.
Introduction: Baroreceptors are a type of mechanoreceptors that are present in the arteries. These receptors are sensitive to stretch, and they maintain the blood pressure. There are two types of baroreceptors. These are carotid baroreceptors and aortic baroreceptors. The role of carotid baroreceptors is to control the flow of blood to the brain. However, the aortic baroreceptors maintain the rate of blood flow to all the other parts of the body.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 15 Solutions
Human Physiology: An Integrated Approach (7th Edition)
Ch. 15 - Would you expect to find valves in the veins...Ch. 15 - Prob. 2CCCh. 15 - Who has the higher pulse pressure, someone with...Ch. 15 - The formula given for calculating MAP applies to a...Ch. 15 - Prob. 5CCCh. 15 - Resistance to blood flow is determined primarily...Ch. 15 - Prob. 7CCCh. 15 - Prob. 8CCCh. 15 - Skeletal muscle arterioles have both - and...Ch. 15 - Prob. 10CC
Ch. 15 - Prob. 11CCCh. 15 - Prob. 12CCCh. 15 - In the classic movie Jurassic Park, Dr. Ian...Ch. 15 - A man with liver disease loses the ability to...Ch. 15 - Prob. 15CCCh. 15 - Prob. 16CCCh. 15 - Malnourished children who have inadequate protein...Ch. 15 - Prob. 1RQCh. 15 - Prob. 2RQCh. 15 - Prob. 3RQCh. 15 - Prob. 4RQCh. 15 - Prob. 5RQCh. 15 - Prob. 6RQCh. 15 - List the factors that aid venous return to the...Ch. 15 - Prob. 8RQCh. 15 - Prob. 9RQCh. 15 - Prob. 10RQCh. 15 - Prob. 11RQCh. 15 - Most systemic arterioles are innervated by the...Ch. 15 - Match each event in the left column with all...Ch. 15 - Which organs receive more than two-thirds of the...Ch. 15 - By looking at the density of capillaries in a...Ch. 15 - Prob. 16RQCh. 15 - Prob. 17RQCh. 15 - Define edema. List some ways in which it can...Ch. 15 - Prob. 19RQCh. 15 - Prob. 20RQCh. 15 - Calcium channel blockers prevent Ca2+ movement...Ch. 15 - Prob. 22RQCh. 15 - Prob. 23RQCh. 15 - Define myogenic autoregulation. What mechanisms...Ch. 15 - Left ventricular failure may be accompanied by...Ch. 15 - Robert is a 52-year-old nonsmoker. He weighs 180...Ch. 15 - The following figure is a schematic representation...Ch. 15 - Prob. 28RQCh. 15 - Draw a reflex map that explains Anthonys vasovagal...Ch. 15 - Prob. 30RQCh. 15 - Prob. 31RQCh. 15 - Prob. 32RQCh. 15 - Prob. 33RQCh. 15 - Prob. 34RQCh. 15 - Prob. 35RQCh. 15 - Prob. 36RQCh. 15 - Prob. 37RQCh. 15 - Prob. 38RQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license