
Human Physiology: An Integrated Approach (7th Edition)
7th Edition
ISBN: 9780321981226
Author: Dee Unglaub Silverthorn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15, Problem 16CC
Summary Introduction
To determine: The set of blood vessels in which blood will flow back if the left ventricle fails to pump.
Introduction: Heart is a muscular organ that pumps blood to the other parts of the body through the circulatory system. In humans, the heart is divided into four chambers, two atria, and two ventricles.
Summary Introduction
To determine: The organ in which edema will occur.
Introduction: When the fluid or blood traps in the tissues of the body, it makes the organ swelled. This swelling is known as the edema. Edema can be noticed on many parts of the body like legs, hands, abdomen, and so on.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 15 Solutions
Human Physiology: An Integrated Approach (7th Edition)
Ch. 15 - Would you expect to find valves in the veins...Ch. 15 - Prob. 2CCCh. 15 - Who has the higher pulse pressure, someone with...Ch. 15 - The formula given for calculating MAP applies to a...Ch. 15 - Prob. 5CCCh. 15 - Resistance to blood flow is determined primarily...Ch. 15 - Prob. 7CCCh. 15 - Prob. 8CCCh. 15 - Skeletal muscle arterioles have both - and...Ch. 15 - Prob. 10CC
Ch. 15 - Prob. 11CCCh. 15 - Prob. 12CCCh. 15 - In the classic movie Jurassic Park, Dr. Ian...Ch. 15 - A man with liver disease loses the ability to...Ch. 15 - Prob. 15CCCh. 15 - Prob. 16CCCh. 15 - Malnourished children who have inadequate protein...Ch. 15 - Prob. 1RQCh. 15 - Prob. 2RQCh. 15 - Prob. 3RQCh. 15 - Prob. 4RQCh. 15 - Prob. 5RQCh. 15 - Prob. 6RQCh. 15 - List the factors that aid venous return to the...Ch. 15 - Prob. 8RQCh. 15 - Prob. 9RQCh. 15 - Prob. 10RQCh. 15 - Prob. 11RQCh. 15 - Most systemic arterioles are innervated by the...Ch. 15 - Match each event in the left column with all...Ch. 15 - Which organs receive more than two-thirds of the...Ch. 15 - By looking at the density of capillaries in a...Ch. 15 - Prob. 16RQCh. 15 - Prob. 17RQCh. 15 - Define edema. List some ways in which it can...Ch. 15 - Prob. 19RQCh. 15 - Prob. 20RQCh. 15 - Calcium channel blockers prevent Ca2+ movement...Ch. 15 - Prob. 22RQCh. 15 - Prob. 23RQCh. 15 - Define myogenic autoregulation. What mechanisms...Ch. 15 - Left ventricular failure may be accompanied by...Ch. 15 - Robert is a 52-year-old nonsmoker. He weighs 180...Ch. 15 - The following figure is a schematic representation...Ch. 15 - Prob. 28RQCh. 15 - Draw a reflex map that explains Anthonys vasovagal...Ch. 15 - Prob. 30RQCh. 15 - Prob. 31RQCh. 15 - Prob. 32RQCh. 15 - Prob. 33RQCh. 15 - Prob. 34RQCh. 15 - Prob. 35RQCh. 15 - Prob. 36RQCh. 15 - Prob. 37RQCh. 15 - Prob. 38RQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage