Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 14.9, Problem 1MQ
Summary Introduction
Electrons are the negatively charged subatomic particles. They spin around the nucleus in orbit in different shell like p, s, and d. When electrons jump from one orbit to another it releases energy in name of photons. Each and every atom has unique electron numbers. Hydrogen element has one electron in its outer orbit and termed as 1H.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 14 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 14.1 - What is the fundamental difference between an...Ch. 14.1 - What is the purpose of chlorophyll and...Ch. 14.1 - Why can phototrophic green bacteria grow at light...Ch. 14.1 - What are the functions of light-harvesting and...Ch. 14.2 - In which phototrophs are carotenoids found?...Ch. 14.2 - How does the structure of a phycobilin compare...Ch. 14.2 - Phycocyanin is blue-green. What color of light...Ch. 14.2 - What accessory pigments are present in...Ch. 14.3 - What parallels exist in the processes of...Ch. 14.3 - What is reverse electron flow and why is it...
Ch. 14.3 - What is the difference between cyclic and...Ch. 14.3 - What is reverse electron transport and why is it...Ch. 14.4 - Differentiate between cyclic and noncyclic...Ch. 14.4 - What is the key role of light energy in the...Ch. 14.4 - What evidence is there that anoxygenic and...Ch. 14.4 - Prob. 1CRCh. 14.5 - Prob. 1MQCh. 14.5 - How much NADPH and ATP is required to make one...Ch. 14.5 - Contrast autotrophy in the following phototrophs:...Ch. 14.5 - QWhat is a carboxysome, and what is its role in...Ch. 14.6 - Prob. 1MQCh. 14.6 - What is FeMo-co and what does it do?Ch. 14.6 - How is acetylene useful in studies of nitrogen...Ch. 14.6 - How might the ability to fix nitrogen help a...Ch. 14.7 - In a coupled reaction, how can you tell the...Ch. 14.7 - How does aerobic respiration differ from anaerobic...Ch. 14.7 - Describe the major differences between...Ch. 14.7 - Prob. 1CRCh. 14.8 - What enzyme is required for hydrogen bacteria to...Ch. 14.8 - Why is reverse electron flow unnecessary in H2...Ch. 14.8 - QWhich inorganic electron donors are used by the...Ch. 14.9 - Prob. 1MQCh. 14.9 - In terms of intermediates, how does the Sox system...Ch. 14.9 - Prob. 1CRCh. 14.10 - Prob. 1MQCh. 14.10 - What is the function of rusticyanin and where is...Ch. 14.10 - How can Fe2+ be oxidized under anoxic conditions?Ch. 14.10 - Prob. 1CRCh. 14.11 - Prob. 1MQCh. 14.11 - Prob. 2MQCh. 14.11 - Prob. 1CRCh. 14.12 - What are the electron donor and acceptor in the...Ch. 14.12 - What does electron transport in anammox bacteria...Ch. 14.12 - Compare CO2 fixation in anammox bacteria and...Ch. 14.12 - Prob. 1CRCh. 14.13 - For Escherichia coli, why is more energy released...Ch. 14.13 - How do the products of NO3 reduction differ...Ch. 14.13 - Where is the dissimilative nitrate reductase found...Ch. 14.13 - Prob. 1CRCh. 14.14 - How is SO42 converted to SO32 during dissimilative...Ch. 14.14 - Contrast the growth of Desulfovibrio on H2 versus...Ch. 14.14 - Give an example of sulfur disproportionation.Ch. 14.14 - Prob. 1CRCh. 14.15 - Prob. 1MQCh. 14.15 - What is reductive dechlorination and why is it...Ch. 14.15 - How does anaerobic glucose catabolism differ in...Ch. 14.15 - Compare and contrast ferric iron reduction with...Ch. 14.16 - What is the purpose of CO dehydrogenase?Ch. 14.16 - If acetogens conserve energy using the Rnf...Ch. 14.16 - What is electron bifurcation and what role does it...Ch. 14.16 - Compare and contrast acetogens with methanogens in...Ch. 14.17 - Which coenzymes function as C1 carriers in...Ch. 14.17 - In methanogens growing on H2 + CO2, how is carbon...Ch. 14.17 - How is ATP made in methanogenesis when the...Ch. 14.17 - What are the major differences in the conservation...Ch. 14.18 - When using CH4 as electron donor, why is...Ch. 14.18 - In which two ways does the ribulose monophosphate...Ch. 14.18 - What is unique about methanotrophy in...Ch. 14.18 - Prob. 1CRCh. 14.19 - Why is H2 produced during many types of...Ch. 14.19 - Why is acetate formation in fermentation...Ch. 14.19 - Define the term substrate-level phosphorylation:...Ch. 14.20 - How can homo- and heterofermentative metabolism be...Ch. 14.20 - Butanediol production leads to greater ethanol...Ch. 14.20 - QWhat are the major fermentation products of...Ch. 14.21 - Compare the mechanisms for energy conservation in...Ch. 14.21 - What type of substrates are fermented by...Ch. 14.21 - What are the substrates for the Clostridium...Ch. 14.21 - Prob. 1CRCh. 14.22 - Why does Propionigenium modestum require sodium...Ch. 14.22 - Of what benefit is the organism Oxalobacter to...Ch. 14.22 - Prob. 3MQCh. 14.22 - Give an example of a fermentation that does not...Ch. 14.23 - Give an example of interspecies H2 transfer. Why...Ch. 14.23 - Why can a pure culture of Syntrophomonas grow on...Ch. 14.23 - Why is syntrophy also called interspecies H2...Ch. 14.24 - How do monooxygenases differ in function from...Ch. 14.24 - What is the final product of catabolism of a...Ch. 14.24 - Prob. 3MQCh. 14.24 - How do monooxygenases differ from dioxygenases in...Ch. 14.25 - What is the benzoyl-CoA pathway, and how might it...Ch. 14.25 - How is hexane oxygenated during anoxic catabolism?Ch. 14.25 - Prob. 1CRCh. 14 - The growth rate of the phototrophic purple...Ch. 14 - Prob. 2AQCh. 14 - A fatty acid such as butyrate cannot be fermented...Ch. 14 - When methane is made from CO2 (plus H2) or from...
Knowledge Booster
Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College