ANATOMY&PHYSIOLOGY W/CONNECT LL
4th Edition
ISBN: 9781266473982
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14.5, Problem 14WDYL
Summary Introduction
To explain:
The difference between the anterior ramus and posterior ramus of a typical spinal nerve.
Concept introduction:
Ramus is the branching of the spinal nerves for the conduction of the impulses in the neurons. It is divided into an anterior ramus and a posterior ramus. Anterior and posterior ramus is the bifurcation and branching of the neurons in the spinal cords which transfer the stimulus ahead.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 14 Solutions
ANATOMY&PHYSIOLOGY W/CONNECT LL
Ch. 14.1 - Prob. 1WDYLCh. 14.1 - Prob. 2WDYLCh. 14.1 - Prob. 3WDYLCh. 14.1 - Prob. 4WDYLCh. 14.2 - Prob. 5WDYLCh. 14.3 - Prob. 6WDYLCh. 14.3 - Prob. 7WDYLCh. 14.3 - Prob. 8WDYLCh. 14.4 - Prob. 9WDYLCh. 14.4 - Prob. 10WDYL
Ch. 14.4 - Prob. 11WDYLCh. 14.4 - Prob. 12WDYLCh. 14.4 - Prob. 13WDYLCh. 14.5 - Prob. 14WDYLCh. 14.5 - Prob. 15WDYLCh. 14.5 - Prob. 16WDYLCh. 14.5 - Prob. 17WDYLCh. 14.5 - Prob. 18WDYLCh. 14.5 - Prob. 19WDYLCh. 14.5 - Which nerve might you have damaged if you have...Ch. 14.5 - Prob. 21WDYLCh. 14.5 - Prob. 22WDYLCh. 14.5 - Prob. 23WDYLCh. 14.6 - What are the four main properties of a reflex?Ch. 14.6 - Prob. 25WDYLCh. 14.6 - Prob. 26WDYLCh. 14.6 - What is the major difference between monosynaptic...Ch. 14.6 - Prob. 28WDYLCh. 14.6 - Identify the Golgi tendon reflex (which is an...Ch. 14.6 - Prob. 30WDYLCh. 14.7 - Prob. 31WDYLCh. 14 - Prob. 1DYKBCh. 14 - Prob. 2DYKBCh. 14 - Prob. 3DYKBCh. 14 - Prob. 4DYKBCh. 14 - Prob. 5DYKBCh. 14 - Prob. 6DYKBCh. 14 - Prob. 7DYKBCh. 14 - Prob. 8DYKBCh. 14 - Prob. 9DYKBCh. 14 - Prob. 10DYKBCh. 14 - Prob. 11DYKBCh. 14 - List the three gray matter horns on each side of...Ch. 14 - Compare the main differences between the posterior...Ch. 14 - Prob. 14DYKBCh. 14 - Prob. 15DYKBCh. 14 - Prob. 16DYKBCh. 14 - Prob. 17DYKBCh. 14 - Prob. 18DYKBCh. 14 - Prob. 19DYKBCh. 14 - Prob. 20DYKBCh. 14 - Prob. 1CALCh. 14 - Prob. 2CALCh. 14 - Prob. 3CALCh. 14 - Prob. 4CALCh. 14 - Prob. 5CALCh. 14 - Prob. 1CSLCh. 14 - Prob. 2CSLCh. 14 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeFundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning