EBK CAMPBELL BIOLOGY IN FOCUS
2nd Edition
ISBN: 8220101459299
Author: Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14.3, Problem 2CC
How is RNA splicing similar to how you would watch a TV show recorded earlier using a DVR? In what ways is it different? What would introns correspond to in this analogy?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How is RNA splicing similar to how you would watcha recorded television show? What would introns be?
A protein has the following amino acid sequence:
Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro
You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length.
Q. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results?
Which one of the following options is NOT a step in RNA processing?
Addition of the 5’ G cap
Addition of the 3’ poly A tail
Splicing to remove exons and connect the retained introns
Splicing to remove introns and connect the retained exons
Chapter 14 Solutions
EBK CAMPBELL BIOLOGY IN FOCUS
Ch. 14.1 - MAKE CONNECTIONS In a research article about...Ch. 14.1 - What polypeptide product would you expect from a...Ch. 14.1 - DRAW IT The template strand of a gene contains the...Ch. 14.2 - What is a promoter? Is it located at the upstream...Ch. 14.2 - What enables RNA polymerase to start transcribing...Ch. 14.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 14.3 - Given that there are about 20,000 human genes, how...Ch. 14.3 - How is RNA splicing similar to how you would watch...Ch. 14.3 - WHAT IF? What would be the effect of treating...Ch. 14.4 - What two processes ensure that the correct amino...
Ch. 14.4 - Discuss the ways in which rRNA structure likely...Ch. 14.4 - Describe how a polypeptide to be secreted is...Ch. 14.4 - WHAT IF? DRAW IT Draw a tRNA with the anticodon...Ch. 14.5 - What happens when one nucleotide pair is lost from...Ch. 14.5 - Prob. 2CCCh. 14.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 14 - In eukaryotic cells, transcription cannot begin...Ch. 14 - Prob. 2TYUCh. 14 - The anticodon of a particular tRNA molecule is A....Ch. 14 - Prob. 4TYUCh. 14 - Which component is not directly involved in...Ch. 14 - Prob. 6TYUCh. 14 - Prob. 7TYUCh. 14 - Prob. 8TYUCh. 14 - Fill in the following table: Type of RNA Functions...Ch. 14 - SCIENTIFIC INQUIRY Knowing that the genetic code...Ch. 14 - Prob. 11TYUCh. 14 - FOCUS ON INFORMATION Evolution accounts for the...Ch. 14 - SYNTHESIZE YOUR KNOWLEDGE Some mutations result in...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Figure 1.18 In the example below, the scientific method is used to solve an everyday problem. Which part in the...
Concepts of Biology
Define histology.
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
Human Anatomy
Consider the experiment described in Section 2.1 in which Ted Garland and colleagues bred mice to run long dist...
Evolutionary Analysis (5th Edition)
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science
6. How can you use the features found in each chapter?
Human Anatomy & Physiology (2nd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?arrow_forwardWhich of the following is the correct sequence for RNA splicing: 1. U2 binds to the branch site and ATP is hydrolyzed 2. U1 binds to the GU sequence at 5’ splice 3. U5/U4/U6 trimer binds 4. U2/U5/U6 are bound to lariat and 3’ site is cleaved and exons are ligated using ATP hydrolysis. 5. U1 is release, U5 shifts from exon to intron and U6 binds at the 5’ splice site 6. U4 is released, U6/U2 catalyzes transesterification, U5 binds exon at 3’ splice site, and the5’ site is cleaved. Group of answer choices 4,3,1,2,6,5 5,4,2,3,6,1 3,1,4,2,5,6 1,2,3,4,5,6 2,1,3,5,6,4arrow_forwardThere are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What codons are used and with what frequency?arrow_forward
- What is an Okazaki fragment, and how are they later “glued” together? What are the types and major functions for each type of RNA? Define transcription and translation. Which process occurs first to make protein from DNA? In what direction does a polymerase move when synthesizing a strand of mRNA? What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?arrow_forwardWhy is RNA splicing important to cellular processes and protein synthesis?arrow_forwardWhat is the net gain in the number of chemical bonds during splicing of an intron? Please explain your answer.arrow_forward
- What are the major subunits of a bacterial RNA polymerase? list all of themarrow_forwardThe sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).arrow_forwardWhich is the coding strand? Which is the template strand? What is the direction of mRNA transcription by RNA-Polymerase for this gene?arrow_forward
- The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.arrow_forwardBelow is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.arrow_forwardThe chemical bisulfite transforms cytosine (C) to uracil (U) (U). In DMSO, bisulfite is dissolved. Bisulfite was treated ribosomes. The bisulfite was subsequently removed, and the amount of protein produced was determined using a translation assay. Why do you think we need a DMSO treated control group instead of a group not treated with anything?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY