Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 5P
List at least three features of eukaryotic genomes that are not found in bacterial genome.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What are some reasons why, in multicellular eukaryotes, genome size is not necessarily related to number of protein-coding genes or organismal complexity?
Describe two main reasons why the proteomes of eukaryotes are usuallymuch larger than their genomes.
The following DNA sequences found on the sense strand belong to the same eukaryotic gene:
Sequence 1: 5'-GATTCAATAAAGCTCAGATCGCTCACGTCGCGACTC-3'
Sequence 2: 5'-TCCGAGGTCACTAGATACTCGTCGATCGTATAAATG-3'
a) Which sequence is likely to be found upstream from the coding sequence? Justify
your answer.
b) Which sequence is likely to be found downstream from the coding sequence?
Justify your answer.
c) Which sequence will not be transcribed into an mRNA transcript? Justify your
answer.
Chapter 14 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 14 - Choose the phrase from the right column that best...Ch. 14 - The unicellular, rod-shaped bacterium E. coli is 2...Ch. 14 - Now that the sequence of the entire E. coli K12...Ch. 14 - Bacterial genomes such as that of E. coli...Ch. 14 - List at least three features of eukaryotic genomes...Ch. 14 - Describe a mechanism by which a gene could move...Ch. 14 - High salt concentrations tend to cause protein...Ch. 14 - Recently, scientists tested the possibility that...Ch. 14 - A recent metagenomic study analyzed the...Ch. 14 - Linezolid is a new type of antibiotic that...
Ch. 14 - A liquid culture of E. coli at a concentration of...Ch. 14 - Pick out the medium i, ii, iii, or iv onto which...Ch. 14 - This problem concerns Fig. 14.14, which...Ch. 14 - In two isolates one is resistant to ampicillin,...Ch. 14 - E. coli cells usually have only one copy of the F...Ch. 14 - In E. coli, the genes purC and pyrB are located...Ch. 14 - DNA sequencing of the entire H. influenzae genome...Ch. 14 - Genes encoding toxins are often located on...Ch. 14 - a. You want to perform an interrupted-mating...Ch. 14 - In Problem 19, do you think that most of the...Ch. 14 - One issue with interrupted-mating experiments such...Ch. 14 - Prob. 22PCh. 14 - Starting with an F- strain that was prototrophic...Ch. 14 - You can carry out matings between an Hfr and F...Ch. 14 - Genome sequences show that some pathogenic...Ch. 14 - Generalized and specialized transduction both...Ch. 14 - This problem highlights some useful variations of...Ch. 14 - A researcher has a Trp auxotrophic strain of E....Ch. 14 - Streptococcus parasanguis is a bacterial species...Ch. 14 - The sequence at one end of one strand of the...Ch. 14 - Scientists who study amino acid biosynthesis...Ch. 14 - Suppose that you could obtain radioactively...Ch. 14 - Prob. 34PCh. 14 - Some scientists are trying to engineer...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 26) Eukaryotes are unable to couple transcription and translation because: A) the two processes occur in separate regions of the cell B) they do not have the specialized ribosomes that occur in bacteria C) the genetic code in eukaryotes is incompatible with the formation of polyribosomes D) the mRNA of eukaryotes do not have the appropriate spacers that polycistrons allow for polyribosomes to form E) eukaryotic mRNA molecules are monocistronic. asap please.arrow_forwardWhy might we predict that the organization of eukaryotic genetic material will be more complex than that of viruses or bacteria?arrow_forwardCan these bacteria have either a genome made of RNA or DNA? If so, please explainarrow_forward
- Transposable elements, “jumping genes”, were first described by Barbara McClintock in her Nobel prize winning studies with corn. The genome of every multicellular eukaryote that has been sequenced is composed of a large percentage of transposable elements (often 30% to 50%), but they are nearly absent from the genomes of eubacteria and archaea. What are these things and what do they do? Describe and draw the structural organization and mechanism for movement of transposons and retro- transposable elements. What effect do these elements have on the stability of genomes? can you help me answer the bolded question?arrow_forwardConsidering that prokaryote genomes do not have large introns, how is it possible to move a eukaryotic gene into a transformed bacterium, since they lack a spliceosome?arrow_forwardWhat is the essential component of a typical bacterial genome?arrow_forward
- Name and describe two important functions of eukaryotic DNA that do not code for protein.arrow_forwardApart from genome size, what factors make completeassembly of a eukaryotic genome more difficult than assemblyof a genome from a species of Bacteria or Archaea?arrow_forwardAssume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…arrow_forward
- In Eukaryotes the following are areas of the gene that contain amino acid sequences information A) Exon’s B) Introns C) Activators D) Promotersarrow_forwardThe redundancy of the genetic code means that some amino acids arespecified by more than one codon. For example, the amino acid leucine is specified by six different codons. Within a genome, synonymous codons are not present in equal numbers; some synonymous codons appear much more frequently than others, and the preferred codons differ among species. For example, in one species, the codon UUA might be used most often to specify leucine, whereas in another species, the codon CUU might be used most often. Speculate on a reason for this bias in codon usage and why the preferred codons are not the same in all organisms.arrow_forwardWhy is the genome contained within a membrane?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license