BIOLOGY 12E CONNECT ACCESS CARD
12th Edition
ISBN: 9781264938513
Author: Raven
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14, Problem 1IQ
Summary Introduction
Toexplain: The reason whythe sugar–phosphate backbone ofthe DNA is held together by the covalent bonds and cross-bridges between the two strands are held together by hydrogen bonds.
Introduction: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living organisms. The DNA is a double-stranded helix that contains genetic information for the organism to grow, function, develop, and reproduce.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The nucleotides are very specific as to which bond together. The four nucleotides are:Adenine (A) Thymine (T)Guanine (G) Cytosine (C)They are written out in this order because Adenine always bonds with Thymine and Cytosine alwaysbonds with Guanine. Draw a line connecting those so you remember.Let’s practice making complementary strands.
DNA: T-A-C-T-T-A-C-A-C-G-T-C-A-A-C-G-T-G-C-C-T-T-A-G-C-C-A-T-TDNA: A-T-GGo ahead and write out the complementary strand to the strand above continuing where we left off.
Which of the following statements is (are) true? (a) The two strands of DNA run parallel from their 5' to their 3' ends. (b) An adenine–thymine base pair contains three hydrogen bonds. (c) Positively charged counterions are associated with DNA. (d) DNA base pairs are always perpendicular to the helix axis
What role does bonding play in DNA? Where are hydrogen bonds located? Where are covalent bonds located? Why is that significant to the overall structure and function of DNA
Chapter 14 Solutions
BIOLOGY 12E CONNECT ACCESS CARD
Ch. 14.1 - Describe the experiments of Griffith and Avery.Ch. 14.1 - Evaluate the evidence for DNA as genetic material.Ch. 14.2 - Explain how the WatsonCrick structure rationalized...Ch. 14.2 - Prob. 2LOCh. 14.3 - Prob. 1LOCh. 14.3 - Prob. 2LOCh. 14.4 - Prob. 1LOCh. 14.4 - Prob. 2LOCh. 14.4 - Diagram the functions found at the replication...Ch. 14.5 - Compare eukaryotic replication with prokaryotic.
Ch. 14.5 - Prob. 2LOCh. 14.5 - Prob. 3LOCh. 14.6 - Prob. 1LOCh. 14.6 - Prob. 2LOCh. 14 - Prob. 1DACh. 14 - Prob. 2DACh. 14 - Prob. 1IQCh. 14 - Prob. 2IQCh. 14 - How does the structure of eukaryotic genomes...Ch. 14 - Prob. 4IQCh. 14 - Prob. 1UCh. 14 - Which of the following is NOT a component of DNA?...Ch. 14 - Chargaff studied the composition of DNA from...Ch. 14 - The bonds that hold two complementary strands of...Ch. 14 - Prob. 5UCh. 14 - Prob. 6UCh. 14 - Which of the following is NOT pan of the...Ch. 14 - If one strand of a DNA is 5 ATCGTTAAGCGAGTCA 3,...Ch. 14 - Hershey and Chase used radioactive phosphorus and...Ch. 14 - The Meselson and Stahl experiment used a density...Ch. 14 - Prob. 4ACh. 14 - If the activity of DNA ligase was removed from...Ch. 14 - Successful DNA synthesis requires all of the...Ch. 14 - The synthesis of telomeres a. uses DNA polymerase,...Ch. 14 - When mutations that affected DNA replication were...Ch. 14 - Prob. 1SCh. 14 - In the Meselson-Stahl experiment, a control...Ch. 14 - Enzyme function is critically important for the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- All the following statements about DNA are true, EXCEPT: O DNA is a double-helix, consisting of a sugar-phosphate backbone. O DNA is made up on nucleotides, which consist of one sugar, one phosphate, and one base. O DNA consists of 4 bases - adenine, uracil, cytosine, and guanine. The two main functions of DNA are to replicate itself and to create proteins (by providing the template for protein synthesis). O The sugar in DNA is deoxyribose.arrow_forwardWhat statement about DNA polarity is TRUE? One end of the chain has a 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has a free 5'-OH group or 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group. None is linked to another nucleotide. One end of the chain has a free 3'-OH group or 3'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has only a free 5'-OH group. The other end of the chain has a free 3'-OH group. Neither is linked to another nucleotide. One end of the chain has a free 5'-OH group. The other end of the chain has a free 3'-OH group.arrow_forwardIf a DNA double helix contains 28% T nucleotides, then what is the percentage of A nucleotides?arrow_forward
- DRAW A DNA STRAND WITH 10 ADENINE BASES FOLLOWED BY 10 CYTOSINE BASES. IF THAT SAME STRAND BONDED TO A STRAND OF 15 THYMINE BASE AND 5 GUANINE BASES, HOW WOULD THE DOUBLE HELIC SHAPE VARY FROM A TYPICAL DNA DOUBLE HELIX?arrow_forwardFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forwardIf a DNA double helix that is 100 base pairs in length has32 adenines, how many cytosines, guanines, and thymines must it have?arrow_forward
- In the DNA structure, a purine molecule always binds with a pyrimidine molecule. How would you expect the structure to differ if Adenine forms base pairing with Guanine and Cytosine forms base pairing with Thymidine? Instead of A-T, G-C; can it be A-G, C-T? Justify your answer within five sentencesarrow_forwardWhich of the following is NOT a characteristic of the DNA Double Helix? a) The two strands run in an anti-parallel fashion based on their polarity. b) Hydrogen bonding between nucleotides holds the strands together. c) DNA is 20 Angstrom's wide. d) The percentage of Guanine and Thymine present in a double helix strand are always equal.arrow_forwardIf one side of DNA molecule had a base sequence of adenine-adenine-guanine-cytosine-thymine-cytosine-thymine, what would the sequence of bases on the opposite side of the molecule be?arrow_forward
- List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-Garrow_forwardIf the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?arrow_forwardWhich of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license