ANAT.&PHYS.:INTEGR.APPR. (LL)- W/CONNECT
4th Edition
ISBN: 9781264702039
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14, Problem 19DYKB
Summary Introduction
To explain:
The differences between a stretch and Golgi tendon reflex.
Concept introduction:
Stretch reflex gets activated upon the stretching of muscles. Golgi tendon reflex causes the contraction of muscles and changes in tension. It is composed of sensory nerve endings in a muscle-tendon junction or a tendon.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 14 Solutions
ANAT.&PHYS.:INTEGR.APPR. (LL)- W/CONNECT
Ch. 14.1 - Prob. 1WDYLCh. 14.1 - Prob. 2WDYLCh. 14.1 - Prob. 3WDYLCh. 14.1 - Prob. 4WDYLCh. 14.2 - Prob. 5WDYLCh. 14.3 - Prob. 6WDYLCh. 14.3 - Prob. 7WDYLCh. 14.3 - Prob. 8WDYLCh. 14.4 - Prob. 9WDYLCh. 14.4 - Prob. 10WDYL
Ch. 14.4 - Prob. 11WDYLCh. 14.4 - Prob. 12WDYLCh. 14.4 - Prob. 13WDYLCh. 14.5 - Prob. 14WDYLCh. 14.5 - Prob. 15WDYLCh. 14.5 - Prob. 16WDYLCh. 14.5 - Prob. 17WDYLCh. 14.5 - Prob. 18WDYLCh. 14.5 - Prob. 19WDYLCh. 14.5 - Which nerve might you have damaged if you have...Ch. 14.5 - Prob. 21WDYLCh. 14.5 - Prob. 22WDYLCh. 14.5 - Prob. 23WDYLCh. 14.6 - What are the four main properties of a reflex?Ch. 14.6 - Prob. 25WDYLCh. 14.6 - Prob. 26WDYLCh. 14.6 - What is the major difference between monosynaptic...Ch. 14.6 - Prob. 28WDYLCh. 14.6 - Identify the Golgi tendon reflex (which is an...Ch. 14.6 - Prob. 30WDYLCh. 14.7 - Prob. 31WDYLCh. 14 - Prob. 1DYKBCh. 14 - Prob. 2DYKBCh. 14 - Prob. 3DYKBCh. 14 - Prob. 4DYKBCh. 14 - Prob. 5DYKBCh. 14 - Prob. 6DYKBCh. 14 - Prob. 7DYKBCh. 14 - Prob. 8DYKBCh. 14 - Prob. 9DYKBCh. 14 - Prob. 10DYKBCh. 14 - Prob. 11DYKBCh. 14 - List the three gray matter horns on each side of...Ch. 14 - Compare the main differences between the posterior...Ch. 14 - Prob. 14DYKBCh. 14 - Prob. 15DYKBCh. 14 - Prob. 16DYKBCh. 14 - Prob. 17DYKBCh. 14 - Prob. 18DYKBCh. 14 - Prob. 19DYKBCh. 14 - Prob. 20DYKBCh. 14 - Prob. 1CALCh. 14 - Prob. 2CALCh. 14 - Prob. 3CALCh. 14 - Prob. 4CALCh. 14 - Prob. 5CALCh. 14 - Prob. 1CSLCh. 14 - Prob. 2CSLCh. 14 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College