
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.L1, Problem 5MCQ
Summary Introduction
Introduction:
Hemolysins are a class of bacterial exotoxins that disrupt the cell membrane of red blood cells (and some other cells, too). This damage causes the red blood cells to hemolyze—to burst and release hemoglobin pigment.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 13 Solutions
Foundations in Microbiology
Ch. 13.1 - Describe some of the major interactions between...Ch. 13.1 - Prob. 2ELOCh. 13.1 - Discuss the characteristics of the normal...Ch. 13.1 - Briefly relate the sources and conditions that...Ch. 13.1 - Identify which bodily sites remain free of living...Ch. 13.1 - Prob. 6ELOCh. 13.1 - Prob. 1CYPCh. 13.1 - Prob. 2CYPCh. 13.1 - Prob. 3CYPCh. 13.1 - Prob. 4CYP
Ch. 13.1 - Prob. 5CYPCh. 13.1 - Differentiate between transient and resident...Ch. 13.1 - Explain the factors that cause variations in the...Ch. 13.2 - Review the main stages in the development of an...Ch. 13.2 - Prob. 8ELOCh. 13.2 - Prob. 9ELOCh. 13.2 - Prob. 10ELOCh. 13.2 - Prob. 11ELOCh. 13.2 - Identify and discuss invasive factors and...Ch. 13.2 - Prob. 13ELOCh. 13.2 - Explain several ways in which true pathogens...Ch. 13.2 - Distinguish between pathogenicity and virulence.Ch. 13.2 - Prob. 10CYPCh. 13.2 - Prob. 11CYPCh. 13.2 - Prob. 12CYPCh. 13.2 - Describe several components of pathogens that are...Ch. 13.2 - Prob. 14CYPCh. 13.2 - Prob. 15CYPCh. 13.2 - Define toxigenicity and summarize the main...Ch. 13.2 - Prob. 17CYPCh. 13.3 - Describe the clinical stages of infection.Ch. 13.3 - Use key terms to describe different patterns of...Ch. 13.3 - Prob. 16ELOCh. 13.3 - Prob. 17ELOCh. 13.3 - Explain what is happening during each stage of...Ch. 13.3 - Prob. 19CYPCh. 13.3 - Name some examples of infections and their portals...Ch. 13.3 - 21. Using terminology from this section's “Guide...Ch. 13.4 - Define epidemiology, and summarize the major goals...Ch. 13.4 - Prob. 19ELOCh. 13.4 - Prob. 20ELOCh. 13.4 - Prob. 21ELOCh. 13.4 - Prob. 22ELOCh. 13.4 - Prob. 23ELOCh. 13.4 - Prob. 22CYPCh. 13.4 - Prob. 23CYPCh. 13.4 - Prob. 24CYPCh. 13.4 - Prob. 25CYPCh. 13.4 - Prob. 26CYPCh. 13.4 - What is epidemiologically and medically important...Ch. 13.5 - Prob. 24ELOCh. 13.5 - Prob. 25ELOCh. 13.5 - Summarize the steps in Koch’s postulates, and...Ch. 13.5 - Prob. 27ELOCh. 13.5 - Prob. 28ELOCh. 13.5 - Prob. 28CYPCh. 13.5 - Prob. 29CYPCh. 13.5 - Prob. 30CYPCh. 13.5 - Prob. 31CYPCh. 13.5 - Prob. 32CYPCh. 13.5 - Outline the major factors involved in...Ch. 13.L1 - Prob. 1MCQCh. 13.L1 - Prob. 2MCQCh. 13.L1 - Prob. 3MCQCh. 13.L1 - Prob. 4MCQCh. 13.L1 - Prob. 5MCQCh. 13.L1 - Prob. 6MCQCh. 13.L1 - Prob. 7MCQCh. 13.L1 - The presence of a few bacteria in the blood is...Ch. 13.L1 - Prob. 9MCQCh. 13.L1 - A/an ______ is a passive animal transporter of...Ch. 13.L1 - Prob. 11MCQCh. 13.L1 - Prob. 12MCQCh. 13.L1 - Prob. 13MCQCh. 13.L1 - A positive antibody test for HIV would be a...Ch. 13.L1 - Prob. 15MCQCh. 13.L1 - Prob. 16MCQCh. 13.L1 - Prob. 1CSRCh. 13.L1 - Prob. 2CSRCh. 13.L1 - Prob. 3CSRCh. 13.L1 - Prob. 1WCCh. 13.L1 - Prob. 2WCCh. 13.L1 - Prob. 3WCCh. 13.L1 - Prob. 4WCCh. 13.L1 - Prob. 5WCCh. 13.L1 - Prob. 6WCCh. 13.L1 - Prob. 7WCCh. 13.L1 - a. Outline the five types of clinical isolation....Ch. 13.L1 - Complete the following table. Chemical makeup...Ch. 13.L2 - Discuss the relationship between the vaginal...Ch. 13.L2 - Prob. 2CTCh. 13.L2 - How could the microbiome cause some infections to...Ch. 13.L2 - Each of the nine patient specimens listed below...Ch. 13.L2 - Prob. 5CTCh. 13.L2 - Prob. 6CTCh. 13.L2 - Prob. 7CTCh. 13.L2 - a. Suggest several reasons why respiratory,...Ch. 13.L2 - Summarize the epidemiological findings in the...Ch. 13.L2 - Looking at figure 13.20b. Which pattern of...Ch. 13.L2 - Prob. 1VCCh. 13.L2 - Observe the following maps (a)-(c) of three...Ch. 13.L2 - Prob. 3VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Cardiopulmonary Anatomy & PhysiologyBiologyISBN:9781337794909Author:Des Jardins, Terry.Publisher:Cengage Learning,
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning


Cardiopulmonary Anatomy & Physiology
Biology
ISBN:9781337794909
Author:Des Jardins, Terry.
Publisher:Cengage Learning,
Immune System and Immune Response Animation; Author: Medical Sciences Animations;https://www.youtube.com/watch?v=JDdbUBXPKc4;License: Standard YouTube License, CC-BY
Immune response: summary; Author: Dr Bhavsar Biology;https://www.youtube.com/watch?v=ADANgHkX4OY;License: Standard Youtube License