Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13.4, Problem 1CS
Non-coding RNAs and Protein Sorting
Core Skill: Connections Refer back to Figure 4.32. Which types of proteins need SRP to reach their proper location, and which do not?
Figure 4.32 Three pathways for protein sorting in a eukaryotic cell. Proteins either remain in the cytosol, are sorted to the ER (cotranslational sorting), or are sorted after they are completely synthesized (post-translational sorting).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Concept Overview: Protein Synthesis
Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.
Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge
check.
Transcription
Translation
No Answers Chosen
No Answers Chosen
Transcription & Translation
Neither
No Answers Chosen
No Answers Chosen
Possible answers
DNA is copied into MRNA
Involves tRNA
| Occurs in the mitochondria
Information in MRNA is used to produce a protein
Occurs in the nucleus
Involves mRNA
Utilizes ribosomes
Involves DNA polymerase
Involves RNA polymerase
Occurs in the cytoplasm
::::
::::
::::
Multipass transmembrane proteins synthesized by ribosomes on the rough endoplasmic reticulum generally have which of the following arrangements of start-transfer and stop-transfer signals?
multiple start signals and multiple stop signals (to allow multiple transmembrane regions)
multiple start signals, but only one stop signal (to allow only one transmembrane region)
only one start signal, but multiple stop signals (to allow only one transmembrane region)
only one start signal, and only one stop signal (to allow only one transmembrane region)
only one stop signal, and only one start signal (to allow only one transmembrane region)
Pls Provide what is being asked in the picture given
Chapter 13 Solutions
Biology
Ch. 13.1 - Prob. 1CCCh. 13.2 - Prob. 1CCCh. 13.3 - Prob. 1EQCh. 13.3 - Prob. 2EQCh. 13.3 - Prob. 3EQCh. 13.3 - Effects of Non-coding RNAs on Translation and mRNA...Ch. 13.4 - Non-coding RNAs and Protein Sorting Core Skill:...Ch. 13.5 - Core Skill: Modeling The goal of this modeling...Ch. 13 - Prob. 1TYCh. 13 - Prob. 2TY
Ch. 13 - Prob. 3TYCh. 13 - Prob. 4TYCh. 13 - Prob. 5TYCh. 13 - Prob. 6TYCh. 13 - With regard to miRNAs and siRNAs, which of the...Ch. 13 - Cas1 and Cas2 proteins play a role during which of...Ch. 13 - Which of the following components bind to...Ch. 13 - Abnormalities in the expression of ncRNAs are...Ch. 13 - An ncRNA may have one or more of the following...Ch. 13 - What is RNA interference (RNAi)? Explain how the...Ch. 13 - Prob. 3CQCh. 13 - Prob. 1COQCh. 13 - Go to the PubMed website and search for non-coding...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- VISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.arrow_forwardWorksheet (Nucleic Acid) Name: Section: Date: This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY SOLVED MESSAGE GIVEN: DNA code message --> GAA TAG AAA CTT ACT TAG AGC ATT CCT GCC CTT CGA TGC ATC SOLUTION (steps 1-4) 1. MRNA (built to match the DNA message, letter for letter---- → CUU AUC UUU GAA UGA AUC UCG 2. TRNA (determined by matching letters (bases) with those in mRNA)--- GAA UAG AAA CUU ACU UAG BBEE B 3. Amino acids carried by L I P G I each tRNA (according to dictionary, below)-----------> e S h e 4. Symbols of amino acids:--→ L F Earrow_forwardAssignment 9: Transcribing and Translating a Protein Activity 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to transcribe the code into mRNA, remove an intron segment and translate the MRNA into the protein. In addition you will have to identify the beginning fragment, the middle fragment, and the end fragment. Procedure Copy each of the following sequences onto a separate piece of paper. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGT Sequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACT Sequence C TACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG Divide the sequences into triplets (CODONS) by putting a slash between each group of the three bases. Transcribe the DNA into mRNA. Identify the middle…arrow_forward
- Need helparrow_forwardNeed help herearrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:arrow_forward
- After isolating the rough endoplasmic reticulum from the rest of cytoplasm, you purify the rnas attached to it. What protein/s do you expect these rnas encode? Soluble secreted proteins ER membrane proteins Plasma membrane proteins and ER membrane proteins ER membrane proteins, Soluble secreted proteins, Plasma membrane proteins Plasma membrane proteinsarrow_forwardFrom DNA to Protein 3D what is the location in the cell or organelle where these processes occur, the main enzymes and substrates for each process, details about initiation, elongation, and termination of each process.arrow_forwardPart 1 of 2: Starting from the mRNA that is produced and released into the cytosol, describe in detail how the protein is translated and where this occurs Protein : B-hexoaminidase Location: Lysosomearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license