
Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 13.11, Problem 30CYU
Summary Introduction
To review:
The response called and its indication when Juan injured his back in the fall and ER noticed that his big toe pointed up, whereas other toes were fanned out.
Introduction:
The spinal reflexes are not involved with the higher centers of the brain. It can be segregated into the stretch, flexor, and superficial reflexes. These reflexes are clinically vital to evaluate the condition of the nervous system.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 13 Solutions
Anatomy & Physiology (6th Edition)
Ch. 13.1 - What are the three levels of sensory integration?Ch. 13.1 - Prob. 2CYUCh. 13.1 - Your cortex decodes incoming action potentials...Ch. 13.2 - Your PNS mostly consists of nerves. What else...Ch. 13.2 - Youve cut your finger on a broken beaker in your...Ch. 13.4 - What are tears and what structure secretes them?Ch. 13.4 - Prob. 5CYUCh. 13.4 - Arrange the following in the order that light...Ch. 13.4 - You have been reading this book text for a while...Ch. 13.4 - Prob. 8CYU
Ch. 13.4 - For each of the following, indicate whether it...Ch. 13.4 - Which part of the visual field would be affected...Ch. 13.4 - Prob. 13CYUCh. 13.4 - Name the five taste modalities. Name the three...Ch. 13.5 - Apart from the bony boundaries, which structure...Ch. 13.5 - Which structure inside the spiral organ allows us...Ch. 13.5 - Prob. 17CYUCh. 13.5 - If the brain stem did not receive input from both...Ch. 13.5 - Prob. 19CYUCh. 13.6 - Prob. 20CYUCh. 13.6 - What is in a nerve besides axons?Ch. 13.6 - Wills femoral nerve was crushed while clinicians...Ch. 13.7 - Name the cranial nerve(s) most involved in each of...Ch. 13.8 - Prob. 24CYUCh. 13.8 - After his horse-riding accident, the actor...Ch. 13.9 - What are varicosities and where would you find...Ch. 13.10 - Which parts of the nervous system ultimately plan...Ch. 13.11 - Prob. 28CYUCh. 13.11 - Prob. 29CYUCh. 13.11 - Prob. 30CYUCh. 13.11 - Prob. 31CYUCh. 13 - The large onion-shaped receptors that are found...Ch. 13 - Proprioceptors include all of the following except...Ch. 13 - Prob. 3MCCh. 13 - Prob. 5MCCh. 13 - For each of the following muscles or body regions,...Ch. 13 - Prob. 33MCCh. 13 - Prob. 4MCCh. 13 - Match the names of the cranial nerves in column B...Ch. 13 - Prob. 8MCCh. 13 - The portion of the fibrous layer that is white and...Ch. 13 - Which sequence best describes a normal route for...Ch. 13 - Prob. 11MCCh. 13 - Damage to the medial recti muscles would probably...Ch. 13 - The phenomenon of dark adaptation is best...Ch. 13 - Blockage of the scleral venous sinus might result...Ch. 13 - Nearsightedness is more properly called a. myopia,...Ch. 13 - Of the neurons in the retina, the axons of which...Ch. 13 - Which reactions occur when a person looks at a...Ch. 13 - The blind spot of the eye is a. where more rods...Ch. 13 - Olfactory tract damage would probably affect your...Ch. 13 - Sensory impulses transmitted over the facial,...Ch. 13 - Taste buds are found on the a. anterior part of...Ch. 13 - Gustatory epithelial cells are stimulated by a....Ch. 13 - Olfactory nerve filaments are found a. in the...Ch. 13 - Conduction of sound from the middle ear to the...Ch. 13 - Which of the following statements does not...Ch. 13 - Pitch is to frequency of sound as loudness is to...Ch. 13 - The structure that allows pressure in the middle...Ch. 13 - Which of the following is important in maintaining...Ch. 13 - Equilibrium receptors that report the position of...Ch. 13 - Which of the following is not a possible cause of...Ch. 13 - Which of the following are intrinsic eye muscles?...Ch. 13 - Prob. 32MCCh. 13 - List the structural components of the peripheral...Ch. 13 - Prob. 47SAQCh. 13 - Central pattern generators (CPGs) are found at the...Ch. 13 - Prob. 48SAQCh. 13 - Explain how a crossed-extensor reflex exemplifies...Ch. 13 - What clinical information can be gained by...Ch. 13 - Prob. 46SAQCh. 13 - How do rods and cones differ functionally?Ch. 13 - Where is the fovea centralis, and why is it...Ch. 13 - Prob. 37SAQCh. 13 - Since there are only three types of cones, how can...Ch. 13 - Where are the olfactory sensory neurons, and why...Ch. 13 - (a) Define plexus. (b) Indicate the spinal roots...Ch. 13 - What is the homeostatic value of flexor reflexes?Ch. 13 - Prob. 43SAQCh. 13 - Prob. 1CCSCh. 13 - Prob. 2CCSCh. 13 - Prob. 3CCSCh. 13 - Prob. 1CCSSCh. 13 - Prob. 2CCSSCh. 13 - Prob. 3CCSSCh. 13 - Prob. 4CCSSCh. 13 - Prob. 5CCSS
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning