HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
19th Edition
ISBN: 9780135672990
Author: AMERMAN
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 5CYR
Summary Introduction
To review:
The cranial nerves that are sensory only, primarily motor, and mixed are to be noted.
Introduction:
The propagation of stimuli from and to the brain is mediated by a group of nerves called cranial nerves. Cranial nerves emerge from the brain and spread to the spinal cord. These typically exist as pairs, and perform motor, sensory, or mixed functions.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 13 Solutions
HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
Ch. 13.1 - What two subclasses make up the sensory division...Ch. 13.1 - 2. What is a lower motor neuron? How are upper...Ch. 13.1 - In what ways do the somatic and visceral motor...Ch. 13.1 - Prob. 4QCCh. 13.1 - Prob. 5QCCh. 13.1 - What structures are found in a peripheral nerve?Ch. 13.1 - How are sensations detected in the PNS and...Ch. 13.1 - 8. How are motor impulses transmitted from the...Ch. 13.2 - Prob. 1QCCh. 13.2 - 2. What are the Roman numerals and main...
Ch. 13.2 - 3. What are the Roman numerals and main...Ch. 13.2 - List the 12 pairs of cranial nerves in ascending...Ch. 13.2 - Prob. 5QCCh. 13.3 - Prob. 1QCCh. 13.3 - What are the anterior and posterior rami, and what...Ch. 13.3 - 3. What are the key structures supplied by each...Ch. 13.3 - 4. Differentiate between the trunks and cords of...Ch. 13.3 - Prob. 5QCCh. 13.3 - Prob. 6QCCh. 13.3 - Prob. 7QCCh. 13.4 - 1. What is sensory transduction?
Ch. 13.4 - Prob. 2QCCh. 13.4 - 3. What are the three components of a typical...Ch. 13.4 - What is a first-order sensory neurons receptive...Ch. 13.4 - What is the two-point discrimination threshold,...Ch. 13.4 - What is a dermatome?Ch. 13.4 - 7. Why is visceral pain often perceived as...Ch. 13.5 - 1. What are the main differences between an upper...Ch. 13.5 - 2. What is a motor neuron pool?
Ch. 13.5 - What is the general sequence of events for...Ch. 13.6 - Prob. 1QCCh. 13.6 - 2. How do intrafusal and extrafusal muscle fibers...Ch. 13.6 - What are the functions of primary and secondary...Ch. 13.6 - 4. How do Golgi tendon organs and muscle spindles...Ch. 13.6 - How do polysynaptic and monosynaptic reflex arcs...Ch. 13.6 - Prob. 6QCCh. 13.6 - How are the flexion and crossed-extension reflexes...Ch. 13.6 - What are some potential effects of sensory...Ch. 13.6 - How do upper and lower motor neuron disorders...Ch. 13 - Mark the following statements as true or false. If...Ch. 13 - Prob. 2CYRCh. 13 - 3. Define each of the following terms in your own...Ch. 13 - First, write the Roman numeral that corresponds to...Ch. 13 - Prob. 5CYRCh. 13 - Match the following nerves with the structures...Ch. 13 - First-order somatic sensory neurons are...Ch. 13 - Prob. 8CYRCh. 13 - Prob. 9CYRCh. 13 - 10. Merkel cell fibers, tactile corpuscles,...Ch. 13 - 11. Place the following sequence of events for the...Ch. 13 - How do upper and lower motor neurons differ?Ch. 13 - 13. List and describe the basic steps involved in...Ch. 13 - 14. The lower motor neurons that innervate...Ch. 13 - Fill in the blanks:______ detect the degree to...Ch. 13 - Which of the following is the correct order of...Ch. 13 - 17. Mark the following statements as true or...Ch. 13 - Prob. 18CYRCh. 13 - Prob. 1CYUCh. 13 - Prob. 2CYUCh. 13 - Prob. 3CYUCh. 13 - Prob. 1AYKACh. 13 - Jason presents for evaluation after a severe...Ch. 13 - 3. When Mr. Williams goes to the emergency...Ch. 13 - 4. Maria is a 3-year-old who has been diagnosed...Ch. 13 - Another feature of CIPA is anhidrosis, or the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax