
Concept explainers
A heterozygous individual has _______ for a trait being studied.
a. the same allele on both homologous chromosomes |
b. two different alleles of a gene |
c. a haploid condition, in genetic terms |

Introduction:
Individuals in the population carry a specific set of alleles, known as genotype. The examples of genotype are homozygous and heterozygous. The phenotype of a plant depends on its genotype, and it is the trait of the individual that can be observed.
Answer to Problem 1SA
Correct answer:
Two different alleles of a gene are carried by a heterozygous individual for a trait being studied. Hence, the correct answer is option b.
Explanation of Solution
Reason for correct answer:
Option b. is given as “two different alleles of a gene.”
Locus represents the “location of a gene” on a chromosome. Individuals carry two copies of a gene because their cells are diploid and pairs of the chromosome are present in these cells. These double copies of any gene can be similar, or they can vary as alleles. If an individual carries two different alleles at a particular locus then its genotype would be called heterozygous.
Reason for incorrect answer:
Option a. is given as, “the same allele on both homologous chromosomes.”
If an individual has the same allele on both homologous chromosomes then the individual would be known as homozygous. Hence, option a. is incorrect.
Option c. is given as, “a haploid condition, in genetic terms.”
In individuals there are always two copies of genes are present. So, a heterozygous individual is a diploid condition, not a haploid condition. Hence, option c. is incorrect.
Hence, the options a. and c. are incorrect.
Therefore, the alleles of a gene on both homologous chromosomes would be different in a heterozygous individual. Thus, the correct option is b.
Want to see more full solutions like this?
Chapter 13 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning





