
Human Anatomy
5th Edition
ISBN: 9780073403700
Author: Kenneth S. Saladin Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 13.5.2AYLO
Summary Introduction
To determine:
The origin, location, and fate of neural crest.
Introduction:
The nervous system maintains the coordination by the means of electrical and chemical signals that are transferred from one nerve cell to another nerve cell. The nervous system is majorly divided into the central nervous system (CNS) and the peripheral nervous system (PNS). Nerve cell is the functional unit of the nervous system.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 13 Solutions
Human Anatomy
Ch. 13.1 - Define receptor and effector. Give two examples of...Ch. 13.1 - Prob. 2BYGOCh. 13.1 - Prob. 3BYGOCh. 13.2 - What basic physiological properties do a nerve...Ch. 13.2 - Prob. 2AWYKCh. 13.2 - Prob. 4BYGOCh. 13.2 - Prob. 5BYGOCh. 13.2 - Prob. 6BYGOCh. 13.2 - Prob. 7BYGOCh. 13.3 - From memory, make your own table of the six kinds...
Ch. 13.3 - Prob. 9BYGOCh. 13.3 - Compare the signal conduction speed in myelinated...Ch. 13.3 - Prob. 11BYGOCh. 13.4 - Of all the methods of membrane transport described...Ch. 13.4 - Prob. 12BYGOCh. 13.4 - Prob. 13BYGOCh. 13.4 - Prob. 14BYGOCh. 13.4 - Prob. 15BYGOCh. 13.4 - Prob. 16BYGOCh. 13.4 - Prob. 17BYGOCh. 13.5 - Prob. 18BYGOCh. 13.5 - Prob. 19BYGOCh. 13.5 - What single adult structure arises from all five...Ch. 13.5 - Prob. 21BYGOCh. 13 - The body’s two principal mechanisms of internal...Ch. 13 - Prob. 13.1.2AYLOCh. 13 - The two divisions of the PNS and the two...Ch. 13 - Prob. 13.1.4AYLOCh. 13 - Prob. 13.2.1AYLOCh. 13 - Prob. 13.2.2AYLOCh. 13 - Prob. 13.2.3AYLOCh. 13 - Prob. 13.2.4AYLOCh. 13 - Prob. 13.3.1AYLOCh. 13 - Prob. 13.3.2AYLOCh. 13 - Prob. 13.3.3AYLOCh. 13 - The structure, composition, and function of the...Ch. 13 - The relationship of Schwann cells to the myelin,...Ch. 13 - Prob. 13.3.6AYLOCh. 13 - Prob. 13.3.7AYLOCh. 13 - How the velocity of a nerve singnal varies with a...Ch. 13 - Prob. 13.3.9AYLOCh. 13 - Prob. 13.4.1AYLOCh. 13 - Prob. 13.4.2AYLOCh. 13 - Three types of synapses defined by where the...Ch. 13 - Prob. 13.4.4AYLOCh. 13 - Prob. 13.4.5AYLOCh. 13 - Prob. 13.4.6AYLOCh. 13 - Prob. 13.4.7AYLOCh. 13 - Prob. 13.4.8AYLOCh. 13 - Prob. 13.4.9AYLOCh. 13 - Prob. 13.4.10AYLOCh. 13 - The four principal types of neural circuits...Ch. 13 - Prob. 13.5.1AYLOCh. 13 - Prob. 13.5.2AYLOCh. 13 - Prob. 13.5.3AYLOCh. 13 - Prob. 13.5.4AYLOCh. 13 - Prob. 13.5.5AYLOCh. 13 - Prob. 13.5.6AYLOCh. 13 - The integrative functions of the nervous system...Ch. 13 - Prob. 2TYRCh. 13 - Prob. 3TYRCh. 13 - Prob. 4TYRCh. 13 - Prob. 5TYRCh. 13 - Prob. 6TYRCh. 13 - Another name for the axon of a neuron is nerve...Ch. 13 - Prob. 8TYRCh. 13 - Prob. 9TYRCh. 13 - Which of the following appears earlier than all...Ch. 13 - Prob. 11TYRCh. 13 - Prob. 12TYRCh. 13 - Prob. 13TYRCh. 13 - Neurons receive incoming signals by way of...Ch. 13 - Prob. 15TYRCh. 13 - Prob. 16TYRCh. 13 - Prob. 17TYRCh. 13 - Prob. 18TYRCh. 13 - Prob. 19TYRCh. 13 - Prob. 20TYRCh. 13 - Prob. 1BYMVCh. 13 - Prob. 2BYMVCh. 13 - State a meaning of each word element and give a...Ch. 13 - Prob. 4BYMVCh. 13 - Prob. 5BYMVCh. 13 - Prob. 6BYMVCh. 13 - Prob. 7BYMVCh. 13 - Prob. 8BYMVCh. 13 - Prob. 9BYMVCh. 13 - Prob. 10BYMVCh. 13 - Prob. 1TOFCh. 13 - Prob. 2TOFCh. 13 - Prob. 3TOFCh. 13 - Prob. 4TOFCh. 13 - Prob. 5TOFCh. 13 - Briefly explain why each of the following...Ch. 13 - Determine which five of the following statements...Ch. 13 - Briefly explain why each of the following...Ch. 13 - Prob. 9TOFCh. 13 - Prob. 10TOFCh. 13 - Suppose some hypothetical disease prevented the...Ch. 13 - How would nervous system function be affected if...Ch. 13 - What unusual characteristic of neurons can be...Ch. 13 - Prob. 4TYCCh. 13 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningCardiopulmonary Anatomy & PhysiologyBiologyISBN:9781337794909Author:Des Jardins, Terry.Publisher:Cengage Learning,Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Cardiopulmonary Anatomy & Physiology
Biology
ISBN:9781337794909
Author:Des Jardins, Terry.
Publisher:Cengage Learning,

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Anatomical Position And Directional Terms - Anatomical Terms - Directional Terms Anatomy; Author: Whats Up Dude;https://www.youtube.com/watch?v=pQUMJ6Gh9Bw;License: Standard YouTube License, CC-BY