MICROBIOLOGY W/ACCESS
4th Edition
ISBN: 9781266808685
Author: Cowan
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 10MCQ
Summary Introduction
Introduction:
Outbreaks of food poisoning often result from the food which is a common source of infection. The source of the agent can be soil, handler, or a mechanical vector.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 13 Solutions
MICROBIOLOGY W/ACCESS
Ch. 13.1 - Prob. 1AYPCh. 13.1 - Identify the sites where normal biota is found in...Ch. 13.1 - Discuss how the Human Microbiome Project has...Ch. 13.2 - Prob. 2CFCh. 13.2 - Differentiate between a microbes pathogenicity and...Ch. 13.2 - Prob. 5AYPCh. 13.2 - List the steps a microbe has to take to get to the...Ch. 13.2 - Prob. 7AYPCh. 13.2 - Prob. 8AYPCh. 13.2 - Prob. 9AYP
Ch. 13.2 - Prob. 10AYPCh. 13.2 - Prob. 11AYPCh. 13.2 - Draw and label a curve representing the course of...Ch. 13.2 - Prob. 13AYPCh. 13.2 - List six different modes of horizontal...Ch. 13.2 - Define healthcare-associated infection, listing...Ch. 13.2 - List Kochs postulates, and explain alternative...Ch. 13.3 - Summarize the goals of epidemiology and the role...Ch. 13.3 - Identify why some diseases are notifiable, and...Ch. 13.3 - Prob. 19AYPCh. 13.3 - Discuss the three major types of epidemics, and...Ch. 13.3 - Prob. 21AYPCh. 13.3 - Prob. 22AYPCh. 13 - Prob. 1CFCh. 13 - Prob. 1MCQCh. 13 - Prob. 2MCQCh. 13 - Prob. 3MCQCh. 13 - Prob. 4MCQCh. 13 - Prob. 5MCQCh. 13 - Prob. 6MCQCh. 13 - Prob. 7MCQCh. 13 - Prob. 8MCQCh. 13 - A positive antibody test for HIV would be a...Ch. 13 - Prob. 10MCQCh. 13 - Prob. 11TFCh. 13 - Prob. 12TFCh. 13 - Prob. 13TFCh. 13 - Prob. 14TFCh. 13 - Prob. 15TFCh. 13 - Based upon data from the Human Microbiome Project...Ch. 13 - Prob. 2CTQCh. 13 - Prob. 3CTQCh. 13 - Prob. 4CTQCh. 13 - Prob. 5CTQCh. 13 - Prob. 6CTQCh. 13 - Prob. 7CTQCh. 13 - Prob. 8CTQCh. 13 - Prob. 9CTQCh. 13 - Prob. 10CTQCh. 13 - Prob. 1CCCh. 13 - Prob. 2CCCh. 13 - Prob. 3CCCh. 13 - Prob. 4CCCh. 13 - Prob. 5CCCh. 13 - Prob. 6CCCh. 13 - Prob. 1VCCh. 13 - Prob. 2VCCh. 13 - Appendix D provides guidance for working with...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning