Human Physiology: An Integrated Approach (7th Edition)
7th Edition
ISBN: 9780321981226
Author: Dee Unglaub Silverthorn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 12, Problem 7RQ
Summary Introduction
Introduction: T-tubules are present in the center of the skeletal muscle cell. These tubules are the extensions of the cell membrane and have the ability to penetrate in the center of the cell. T-tubules play an important role in the maintenance of calcium ion concentration.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 12 Solutions
Human Physiology: An Integrated Approach (7th Edition)
Ch. 12 - Identify as many pairs of antagonistic muscle...Ch. 12 - Prob. 2CCCh. 12 - Prob. 3CCCh. 12 - Prob. 4CCCh. 12 - What are the three anatomical elements of a...Ch. 12 - What is the chemical signal at a neuromuscular...Ch. 12 - Prob. 7CCCh. 12 - Prob. 8CCCh. 12 - Prob. 9CCCh. 12 - Name an elastic fiber in the sarcomere that aids...
Ch. 12 - Prob. 11CCCh. 12 - Prob. 12CCCh. 12 - Prob. 13CCCh. 12 - According to the convention for naming enzymes,...Ch. 12 - Prob. 15CCCh. 12 - Prob. 16CCCh. 12 - Summation in muscle fibers means that the...Ch. 12 - Prob. 18CCCh. 12 - Which type of runner would you expect to have more...Ch. 12 - What is the response of a muscle fiber to an...Ch. 12 - Prob. 21CCCh. 12 - One study found that many world-class athletes...Ch. 12 - What is the response of a muscle fiber to an...Ch. 12 - Prob. 24CCCh. 12 - Prob. 25CCCh. 12 - Prob. 26CCCh. 12 - Prob. 27CCCh. 12 - Prob. 28CCCh. 12 - What happens to contraction if a smooth muscle is...Ch. 12 - Prob. 30CCCh. 12 - Prob. 31CCCh. 12 - Prob. 32CCCh. 12 - How can a neuron alter the amount of...Ch. 12 - Prob. 34CCCh. 12 - Prob. 35CCCh. 12 - The three types of muscle tissue found in the...Ch. 12 - Which two muscle types are striated?Ch. 12 - Which type of muscle tissue is controlled only by...Ch. 12 - Arrange the following skeletal muscle components...Ch. 12 - The modified endoplasmic reticulum of skeletal...Ch. 12 - Prob. 6RQCh. 12 - Prob. 7RQCh. 12 - List six proteins that make up the myofibrils....Ch. 12 - List the letters used to label the elements of a...Ch. 12 - Briefly explain the functions of titin and...Ch. 12 - During contraction, the __________ band remains a...Ch. 12 - Explain the sliding filament theory of...Ch. 12 - Explain the roles of troponin, tropomyosin, and...Ch. 12 - Which neurotransmitter is released by somatic...Ch. 12 - What is the motor end plate, and what kinds of...Ch. 12 - Prob. 16RQCh. 12 - Prob. 17RQCh. 12 - Prob. 18RQCh. 12 - The basic unit of contraction in an intact...Ch. 12 - The two functional types of smooth muscle are...Ch. 12 - Prob. 21RQCh. 12 - Prob. 22RQCh. 12 - Prob. 23RQCh. 12 - Define muscle fatigue. Summarize factors that...Ch. 12 - Prob. 25RQCh. 12 - Prob. 26RQCh. 12 - Prob. 27RQCh. 12 - What is the role of the sarcoplasmic reticulum in...Ch. 12 - Compare and contrast: a. fast-twitch...Ch. 12 - Prob. 30RQCh. 12 - One way that scientists study muscles is to put...Ch. 12 - Prob. 32RQCh. 12 - On the basis of what you have learned about muscle...Ch. 12 - Prob. 34RQCh. 12 - Prob. 35RQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license