
Anatomy & Physiology: The Unity of Form and Function
8th Edition
ISBN: 9781259277726
Author: Kenneth S. Saladin Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 10WWTS
Summary Introduction
Introduction:
The nervous system is a complex network of nerve cells. Nerves are the basic unit of the nervous system. The neuron receives process and store information in response to stimuli through chemical and electrical signals. The three fundamental physiological properties of neuron are excitability, conductivity and secretion.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 12 Solutions
Anatomy & Physiology: The Unity of Form and Function
Ch. 12.1 - What is a receptor? Give two examples of...Ch. 12.1 - Distinguish between the central and peripheral...Ch. 12.1 - Prob. 3BYGOCh. 12.1 - What the nervous and endocrine systems have in...Ch. 12.1 - Three fundamental functions of the nervous system;...Ch. 12.1 - Differences between the central nervous system...Ch. 12.1 - The autonomic nervous system and its two divisionsCh. 12.2 - Sketch a multipolar neuron and label its...Ch. 12.2 - Explain the differences between a sensory neuron,...Ch. 12.2 - Prob. 6BYGO
Ch. 12.2 - Prob. 7BYGOCh. 12.2 - Three fundamental physiological properties of...Ch. 12.2 - Prob. 2AYLOCh. 12.2 - Prob. 3AYLOCh. 12.2 - Prob. 4AYLOCh. 12.2 - Ways in winch neurons transport substances between...Ch. 12.3 - Prob. 8BYGOCh. 12.3 - Prob. 9BYGOCh. 12.3 - Prob. 10BYGOCh. 12.3 - Six kinds of neuroglia; the structure and...Ch. 12.3 - Prob. 2AYLOCh. 12.3 - Prob. 3AYLOCh. 12.3 - The regeneration of a damaged nerve fiber; the...Ch. 12.4 - Prob. 11BYGOCh. 12.4 - Prob. 12BYGOCh. 12.4 - Prob. 13BYGOCh. 12.4 - Prob. 14BYGOCh. 12.4 - Prob. 15BYGOCh. 12.4 - Prob. 16BYGOCh. 12.4 - Prob. 17BYGOCh. 12.4 - Prob. 1AYLOCh. 12.4 - What an electrical current is, and how sodium ions...Ch. 12.4 - How stimulation of a neuron generates a local...Ch. 12.4 - Prob. 4AYLOCh. 12.4 - Prob. 5AYLOCh. 12.4 - Prob. 6AYLOCh. 12.4 - Prob. 7AYLOCh. 12.4 - How one action potential triggers another; how the...Ch. 12.4 - Saltatory conduction in a myelinated nerve fiber,...Ch. 12.5 - Prob. 18BYGOCh. 12.5 - Prob. 19BYGOCh. 12.5 - Prob. 20BYGOCh. 12.5 - Prob. 21BYGOCh. 12.5 - Prob. 1AYLOCh. 12.5 - Prob. 2AYLOCh. 12.5 - Prob. 3AYLOCh. 12.5 - Prob. 4AYLOCh. 12.5 - Excitatory synapses; how acetylcholine and...Ch. 12.5 - Prob. 6AYLOCh. 12.5 - Prob. 7AYLOCh. 12.5 - Prob. 8AYLOCh. 12.5 - Prob. 9AYLOCh. 12.6 - Prob. 22BYGOCh. 12.6 - Prob. 23BYGOCh. 12.6 - Prob. 24BYGOCh. 12.6 - Contrast serial and parallel processing and...Ch. 12.6 - Prob. 26BYGOCh. 12.6 - Explain how long-term potentiation and long-term...Ch. 12.6 - Prob. 1AYLOCh. 12.6 - Prob. 2AYLOCh. 12.6 - Prob. 3AYLOCh. 12.6 - How a postsynaptic neurons decision to fire...Ch. 12.6 - Prob. 5AYLOCh. 12.6 - Mechanisms of presynaptic facilitation and...Ch. 12.6 - Prob. 7AYLOCh. 12.6 - Prob. 8AYLOCh. 12.6 - The meanings of neural pool and neural circuitCh. 12.6 - The difference between a neurons discharge zone...Ch. 12.6 - Diverging, converging, reverberating, and parallel...Ch. 12.6 - The difference between serial and parallel...Ch. 12.6 - The cellular basis of memory; what memory consists...Ch. 12.6 - Prob. 14AYLOCh. 12.6 - Prob. 15AYLOCh. 12 - The integrative functions of the nervous system...Ch. 12 - The highest density of voltage-gated ion channels...Ch. 12 - The soma of a mature neuron lacks a. a nucleus. b....Ch. 12 - The glial cells that fight infections in the CNS...Ch. 12 - Posttetanic potentiation of a synapse increases...Ch. 12 - An IPSP is_____of the postsynaptic neuron. a. a...Ch. 12 - Prob. 7TYRCh. 12 - Prob. 8TYRCh. 12 - Prob. 9TYRCh. 12 - Prob. 10TYRCh. 12 - Prob. 11TYRCh. 12 - Prob. 12TYRCh. 12 - Prob. 13TYRCh. 12 - Prob. 14TYRCh. 12 - Prob. 15TYRCh. 12 - A myelinated nerve fiber can produce action...Ch. 12 - Prob. 17TYRCh. 12 - Prob. 18TYRCh. 12 - Prob. 19TYRCh. 12 - Prob. 20TYRCh. 12 - Prob. 1BYMVCh. 12 - Prob. 2BYMVCh. 12 - Prob. 3BYMVCh. 12 - Prob. 4BYMVCh. 12 - Prob. 5BYMVCh. 12 - Prob. 6BYMVCh. 12 - Prob. 7BYMVCh. 12 - Prob. 8BYMVCh. 12 - Prob. 9BYMVCh. 12 - Prob. 10BYMVCh. 12 - Prob. 1WWTSCh. 12 - Prob. 2WWTSCh. 12 - Prob. 3WWTSCh. 12 - Prob. 4WWTSCh. 12 - Excitatory postsynaptic potentials lower the...Ch. 12 - Prob. 6WWTSCh. 12 - Prob. 7WWTSCh. 12 - Myelinated nerve fibers conduct signals more...Ch. 12 - Prob. 9WWTSCh. 12 - Prob. 10WWTSCh. 12 - Schizophrenia is sometimes treated with drugs such...Ch. 12 - Hyperkalemia is an excess of potassium ill the...Ch. 12 - Suppose a poison were to slow down the Na+-K+...Ch. 12 - Prob. 4TYCCh. 12 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning