Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11.6, Problem 1MQ
- During transformation a cell usually incorporates only one or a few fragments of DNA. Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Why is DNA replication is considered a semi-discontinuous process? Explain in detail.
Why is it important for DNA to be copied before a cell undergoes mitosis?
In apoptosis, a process of programmed cell death, the cell undergoes controlled degradation of cellular components including nuclear DNA
Researchers have noted that if the DNA is isolated from an apoptotic cell, it appears as distinct bands of multiples of approximately 145 bases
in length. Why does this occur?
Multiple Choice
There is a specific DNase that digests DNA every 145 base pairs.
DNA sequences that appear every 145 base pairs allows for easier DNA breakage.
DNA that is wrapped around the histones is not being degraded.
DNA is coated with transcription factors every 145 base pairs.
Chapter 11 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 11.1 - Distinguish between a mutation and a mutant.Ch. 11.1 - Distinguish between screening and selection.Ch. 11.1 - Prob. 3MQCh. 11.1 - Write a one-sentence definition of the term...Ch. 11.2 - Do missense mutations occur in genes encoding...Ch. 11.2 - Why do frameshift mutations generally have more...Ch. 11.2 - Prob. 1CRCh. 11.3 - Why are suppressor tRNA mutations not lethal?Ch. 11.3 - Which class of mutation, missense or nonsense, is...Ch. 11.3 - What is the difference between same-site and...
Ch. 11.4 - Prob. 1MQCh. 11.4 - Prob. 2MQCh. 11.4 - Prob. 1CRCh. 11.5 - Which protein, found in virtually all cells,...Ch. 11.5 - Explain the fate of transferred chromosomal DNA if...Ch. 11.5 - Prob. 3MQCh. 11.5 - What are heteroduplex regions of DNA and what...Ch. 11.6 - During transformation a cell usually incorporates...Ch. 11.6 - In genetic transformation, what is meant by the...Ch. 11.6 - QExplain why recipient cells do not successfully...Ch. 11.7 - Prob. 1MQCh. 11.7 - What is the major difference between generalized...Ch. 11.7 - Why is phage conversion considered beneficial to...Ch. 11.7 - QExplain how a generalized transducing particle...Ch. 11.8 - In conjugation, how are donor and recipient cells...Ch. 11.8 - Explain how rolling circle DNA replication allows...Ch. 11.8 - QWhat is a sex pilus and which cell type, F or F+,...Ch. 11.9 - In conjugation involving the F plasmid of...Ch. 11.9 - Prob. 2MQCh. 11.9 - Prob. 3MQCh. 11.9 - QWhat is a merodiploid and how does an F plasmid...Ch. 11.10 - Why is it usually more difficult to select...Ch. 11.10 - Why do penicillins not kill species of Archaea?Ch. 11.10 - Explain one type of conjugation in Archaea and how...Ch. 11.11 - Prob. 1MQCh. 11.11 - What is the significance of the terminal inverted...Ch. 11.11 - How can transposons be used in bacterial genetics?Ch. 11.11 - Prob. 1CRCh. 11.12 - Why is the CRISPR system considered a prokaryotic...Ch. 11.12 - Prob. 2MQCh. 11.12 - QExplain why incoming DNA recognized by a short...Ch. 11 - A constitutive mutant is a strain that...Ch. 11 - Although a large number of mutagenic chemicals are...Ch. 11 - Why is it difficult in a single experiment to...Ch. 11 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Look at the picture carefully below and imagine inside a cell nucleus. a) encircle and name the parts where DNA is most accessible and least accessible b) how nucleosome positioning or spacing can interfere with DNA accessiblityarrow_forwardBelow is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from numbers and end at specific points. Answer the questions relating to the locations specified by the numbers (1) Which end (5' or 3') of the molecule is here? (2) Which enzyme is probably functioning here to deal with supercoils in the DNA? (3) Which enzyme is probably functioning here to unwind the DNA?arrow_forwardA major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?arrow_forward
- Why do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardTelomerase is not active in most human cells. Some cancer biologists have suggested that activation of the telomerase gene would be a requirement for a cell to become cancerous. Explain why this might be the case.arrow_forward
- Each peak in a chromatogram corresponds to: A fluorescent ddNTP which has been released from the DNA fragment resulting in the termination of synthesis A fluorescent dNTP which has been released from the DNA fragment resulting in the termination of synthesis A fluorescent dNTP which has been incorporated into the DNA fragment resulting in the termination of synthesis. A fluorescent ddNTP which has been incorporated into the DNA fragment resulting in the termination of synthesisarrow_forwardDraw replication forks that show what you would expect to see if a cell were unable to make the following enzymes: DNA Polymerase Helicase Primase Ligasearrow_forwardBackground: DNA nucleotides (i.e A, T, G, and C) are naturally found in a paired, or bonded, arrangement (i.e. the double helix) within the nucleus of every cell. This structure makes the process of replication that occurs prior to mitosis and meiosis very reliable. The purpose of DNA, though, is not simply to make copies of itself, but to provide a set of instructions for the synthesis or "construction" of biomolecules, such as proteins. Why is transcription (i.e. the formation of an RNA copy of a given gene) a necessary step in the "construction" process highlighted above? What is the cell looking to ultimately do with this RNA information?arrow_forward
- Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t copy and paste from Google thank youarrow_forwardThe diagram below shows a section of double-stranded DNA undergoing both transcription and replication. RNA polymerase (gray oval) is bound to the transcriptional template strand and moving from left to right (arrow). The resulting RNA transcript is also shown (dotted line) with limited base pairing to the template strand. The DNA sequence is specified for a portion of the double-stranded DNA. IMAGE a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand (upper or lower) is the template for lagging strand synthesis c. Indicate the nucleotide sequence of the RNA that was transcribed from the DNA region specified by the sequence. Label the 5' and 3' ends of this sequence.arrow_forwardIf mutations occur in DNA, there are several mechanisms by which a cell can repair the defect. One method that can be used is nucleotide extision repair. All of the following characterize nucleotide excision repair, except: DNA ligase will replace the excised DNA and seal the backbone Enzymes can cleave the damaged region DNA can be opened to form a bubble so proteins can access the damaged DNA Can identify thymine dimersarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license