
Seeley's Anatomy & Physiology
12th Edition
ISBN: 9781260399127
Author: VanPutte, Cinnamon
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.5, Problem 25AYP
Define ligand, receptor, and receptor site.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 11 Solutions
Seeley's Anatomy & Physiology
Ch. 11.1 - List and give examples of the general functions of...Ch. 11.2 - Name the components of the CNS and the PNS.Ch. 11.2 - What are the following: sensory receptor, nerve,...Ch. 11.2 - Based on the direction they transmit action...Ch. 11.2 - Based on the structures they supply, what are the...Ch. 11.2 - Where are the cell bodies of sensory, somatic...Ch. 11.2 - What are the subcategories of the ANS?Ch. 11.2 - Compare the general functions of the CNS and the...Ch. 11.3 - Describe and give the function of a neuron cell...Ch. 11.3 - What is the function of the trigger zone?
Ch. 11.3 - Prob. 11AYPCh. 11.3 - Describe the three types of neurons based on...Ch. 11.3 - Prob. 13AYPCh. 11.3 - What characteristic makes glial cells different...Ch. 11.3 - Which glial cells are found in the CNS? In the...Ch. 11.3 - Which type of glial cell Supports neurons and...Ch. 11.3 - Name the different kinds of glial cells that ore...Ch. 11.3 - Prob. 18AYPCh. 11.3 - How do myelinated axons differ from unmyelinated...Ch. 11.4 - What makes up gray matter and white matter?Ch. 11.4 - Prob. 21AYPCh. 11.5 - Describe the concentration differences for Na+ and...Ch. 11.5 - Prob. 23AYPCh. 11.5 - Describe leak ion channels and go ted ion...Ch. 11.5 - Define ligand, receptor, and receptor site.Ch. 11.5 - What kinds of stimuli cause gated ion channels to...Ch. 11.5 - Prob. 27AYPCh. 11.5 - Prob. 28AYPCh. 11.5 - Prob. 29AYPCh. 11.5 - What happens to cause depolarization and...Ch. 11.5 - Prob. 31AYPCh. 11.5 - Prob. 32AYPCh. 11.5 - How does on action potential differ from a local...Ch. 11.5 - Prob. 34AYPCh. 11.5 - Prob. 35AYPCh. 11.5 - Prob. 36AYPCh. 11.5 - Prob. 37AYPCh. 11.5 - Prob. 38AYPCh. 11.5 - What is action potential frequency? What two...Ch. 11.5 - Describe sub-threshold threshold, maximal,...Ch. 11.5 - Prob. 41AYPCh. 11.5 - What prevents on action potential from reversing...Ch. 11.5 - Prob. 43AYPCh. 11.5 - Prob. 44AYPCh. 11.5 - Prob. 45AYPCh. 11.6 - What are the components of a synapse? What is the...Ch. 11.6 - What is on electrical synapse? Describe its...Ch. 11.6 - Describe the release of neurotransmitter In a...Ch. 11.6 - Prob. 49AYPCh. 11.6 - Prob. 50AYPCh. 11.6 - Prob. 51AYPCh. 11.6 - Explain the production of EPSPs and IPSPs. Why are...Ch. 11.6 - Prob. 53AYPCh. 11.6 - Prob. 54AYPCh. 11.6 - Prob. 55AYPCh. 11.6 - Prob. 56AYPCh. 11.7 - Diagram a convergent pathway, a divergent pathway,...Ch. 11 - The part of the nervous system that controls...Ch. 11 - Motor neurons and interneurons are _______...Ch. 11 - Cells found in the choroid plexuses that secrete...Ch. 11 - Glial cells that are phagocytic within the central...Ch. 11 - Action potentials are conducted more rapidly In...Ch. 11 - Clusters of neuron cell bodies within the...Ch. 11 - Prob. 7RACCh. 11 - Prob. 8RACCh. 11 - Compared with the inside of the resting plasma...Ch. 11 - Prob. 10RACCh. 11 - Prob. 11RACCh. 11 - If the permeability of the plasma membrane to K+...Ch. 11 - Decreasing the extracellular concentration of K+...Ch. 11 - Prob. 14RACCh. 11 - Which of these statements about ion movement...Ch. 11 - Prob. 16RACCh. 11 - Graded potentials a. spread over the plasma...Ch. 11 - During the depolarization phase of an action...Ch. 11 - Prob. 19RACCh. 11 - Prob. 20RACCh. 11 - Prob. 21RACCh. 11 - Neurotransmitter substances are stored in vesicles...Ch. 11 - In a chemical synapse, Action potentials in the...Ch. 11 - An inhibitory presynaptic neuron can affect a...Ch. 11 - Summation Is caused by combining two or more...Ch. 11 - In convergent pathways. a. the response of the...Ch. 11 - A child eats a whole bottle of salt (NaCl)...Ch. 11 - Prob. 2CTCh. 11 - Prob. 3CTCh. 11 - Prob. 4CTCh. 11 - The speed of action potential propagation and...Ch. 11 - Prob. 6CTCh. 11 - Strychnine blocks receptor sites for inhibitory...Ch. 11 - Prob. 8CTCh. 11 - Prob. 9CTCh. 11 - Prob. 10CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY