
Pearson eText for Visual Anatomy & Physiology -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780137503100
Author: Frederic Martini, William Ober
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11.2, Problem 10R
Summary Introduction
To describe: The factor that influences the local currents that associate with graded potential.
Introduction: The changes in the membrane potential of the plasma membrane in the neuron are stimuli for the neural activity. The plasma membrane is a selectively permeable membrane that has gated channels for the passage of ions to conduct neural activity.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 11 Solutions
Pearson eText for Visual Anatomy & Physiology -- Instant Access (Pearson+)
Ch. 11.1 - Prob. 1RCh. 11.1 - Prob. 2RCh. 11.1 - Prob. 3RCh. 11.1 - Prob. 4RCh. 11.1 - Prob. 5RCh. 11.1 - Prob. 6RCh. 11.1 - Prob. 7RCh. 11.1 - Prob. 8RCh. 11.1 - Prob. 9RCh. 11.1 - Prob. 10R
Ch. 11.1 - Prob. 11RCh. 11.1 - Prob. 1LOCh. 11.1 - Prob. 2LOCh. 11.1 - Prob. 3LOCh. 11.1 - Prob. 4LOCh. 11.1 - Prob. 5LOCh. 11.1 - Prob. 1ICh. 11.1 - Prob. 2ICh. 11.1 - Prob. 3ICh. 11.1 - Prob. 1SRCh. 11.1 - Labeling: Label each of the structures in the...Ch. 11.1 - Labeling: Label each of the structures in the...Ch. 11.1 - Prob. 4SRCh. 11.1 - Prob. 5SRCh. 11.1 - Prob. 6SRCh. 11.1 - Prob. 7SRCh. 11.1 - Prob. 8SRCh. 11.1 - Prob. 9SRCh. 11.1 - Prob. 10SRCh. 11.1 - Prob. 11SRCh. 11.1 - Prob. 12SRCh. 11.1 - Prob. 13SRCh. 11.1 - Prob. 14SRCh. 11.1 - Prob. 15SRCh. 11.1 - Prob. 16SRCh. 11.1 - Prob. 17SRCh. 11.1 - Prob. 18SRCh. 11.1 - Prob. 19SRCh. 11.1 - Prob. 20SRCh. 11.2 - Define membrane potential.
Ch. 11.2 - Prob. 2RCh. 11.2 - Prob. 3RCh. 11.2 - Prob. 4RCh. 11.2 - Prob. 5RCh. 11.2 - Prob. 6RCh. 11.2 - Prob. 7RCh. 11.2 - Prob. 8RCh. 11.2 - Prob. 9RCh. 11.2 - Prob. 10RCh. 11.2 - Prob. 11RCh. 11.2 - Prob. 12RCh. 11.2 - C. Compare the absolute refractory period with the...Ch. 11.2 - Prob. 14RCh. 11.2 - Prob. 15RCh. 11.2 - Prob. 16RCh. 11.2 - Prob. 17RCh. 11.2 - Prob. 18RCh. 11.2 - Prob. 19RCh. 11.2 - Prob. 20RCh. 11.2 - Prob. 21RCh. 11.2 - Prob. 22RCh. 11.2 - Prob. 23RCh. 11.2 - Describe the general role of membrane potential...Ch. 11.2 - Explain how the resting membrane potential is...Ch. 11.2 - Describe the functions of gated ion channels with...Ch. 11.2 - Describe graded potentials.
Ch. 11.2 - Prob. 5LOCh. 11.2 - Describe continuous propagation and saltatory...Ch. 11.2 - Describe the general structure of synapses in the...Ch. 11.2 - Discuss the significance of postsynaptic...Ch. 11.2 - Discuss the interactions that make information...Ch. 11.2 - Prob. 1ICh. 11.2 - Prob. 2ICh. 11.2 - Prob. 3ICh. 11.2 - Vocabulary: Write the term for each of the...Ch. 11.2 - Vocabulary: Write the term for each of the...Ch. 11.2 - Vocabulary: Write the term for each of the...Ch. 11.2 - Vocabulary: Write the term for each of the...Ch. 11.2 - Vocabulary: Write the term for each of the...Ch. 11.2 - Vocabulary: Write the term for each of the...Ch. 11.2 - Vocabulary: Write the term for each of the...Ch. 11.2 - Vocabulary: Write the term for each of the...Ch. 11.2 - Short answer: For the following diagram of a...Ch. 11.2 - Section integration: Guillain-Barré (ghē-YAN...Ch. 11 - Prob. 1CRQCh. 11 - Prob. 2CRQCh. 11 - Prob. 3CRQCh. 11 - Prob. 4CRQCh. 11 - Prob. 5CRQCh. 11 - Prob. 6CRQCh. 11 - Prob. 7CRQCh. 11 - Prob. 8CRQCh. 11 - Prob. 9CRQCh. 11 - Prob. 10CRQCh. 11 - Prob. 11CRQCh. 11 - Prob. 12CRQCh. 11 - Prob. 13CRQCh. 11 - Prob. 14CRQCh. 11 - Prob. 15CRQCh. 11 - Prob. 16CRQCh. 11 - Prob. 17CRQCh. 11 - Prob. 18CRQCh. 11 - Prob. 19CRQCh. 11 - Prob. 20CRQCh. 11 - Prob. 21CRQCh. 11 - Prob. 22CRQCh. 11 - Prob. 23CRQCh. 11 - Prob. 24CRQCh. 11 - Prob. 25CRQCh. 11 - Prob. 26CRQCh. 11 - Prob. 27CRQCh. 11 - Prob. 28CRQCh. 11 - Prob. 29CRQCh. 11 - What three functional classes of neurons are found...Ch. 11 - Prob. 31CRQCh. 11 - Prob. 32CRQCh. 11 - Prob. 33CRQCh. 11 - Prob. 1CICh. 11 - Prob. 2CICh. 11 - Prob. 3CI
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax