Loose Leaf For Anatomy & Physiology: An Integrative Approach
3rd Edition
ISBN: 9781260162493
Author: McKinley Dr., Michael; O'Loughlin, Valerie; Bidle, Theresa
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 11, Problem 5DYB
Summary Introduction
Concept introduction: Muscle is a type of soft tissue found in animals and humans. There are three types of muscles, such as striated muscle, non-striated, and cardiac muscle. The muscles for facial expression are originated in superficial fascia or on skull bones. They are inserted in superficial fascia of skin and on the contraction of these muscles pull on the skin.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 11 Solutions
Loose Leaf For Anatomy & Physiology: An Integrative Approach
Ch. 11.1 - LEARNING OBJECTIVE
1. Compare and contrast the...Ch. 11.1 - WHAT DID YOU LEARN?
1 What is the difference...Ch. 11.1 - LEARNING OBJECTIVE
2. Describe and differentiate...Ch. 11.1 - Which muscle is strongera pennate muscle or a...Ch. 11.1 - Prob. 3LOCh. 11.1 - What is the difference between an agonist and a...Ch. 11.2 - LEARNING OBJECTIVES
4. List the seven...Ch. 11.2 - LEARNING OBJECTIVE
5. Give examples of muscles...Ch. 11.2 - What are some words used in muscle names that...Ch. 11.2 - The gluteus maximus muscle gets its name from...
Ch. 11.3 - Prob. 6LOCh. 11.3 - Prob. 7LOCh. 11.3 - Prob. 6WDLCh. 11.3 - Prob. 7WDLCh. 11.3 - Prob. 8LOCh. 11.3 - Prob. 9LOCh. 11.3 - Which extrinsic eye muscles abduct the eye (move...Ch. 11.3 - Prob. 10LOCh. 11.3 - Prob. 11LOCh. 11.3 - Prob. 12LOCh. 11.3 - Prob. 9WDLCh. 11.3 - Prob. 10WDLCh. 11.3 - Prob. 13LOCh. 11.3 - Prob. 1WDTCh. 11.3 - List the four suprahyoid muscles, and describe a...Ch. 11.3 - Prob. 14LOCh. 11.3 - Which neck muscles extend the neck? Which neck...Ch. 11.4 - Prob. 15LOCh. 11.4 - Prob. 16LOCh. 11.4 - Which muscles form the erector spinae, and what...Ch. 11.5 - Prob. 17LOCh. 11.5 - Prob. 18LOCh. 11.5 - Prob. 2WDTCh. 11.5 - Prob. 14WDLCh. 11.5 - How is the diaphragm involved in respiration?Ch. 11.6 - LEARNING OBJECTIVES
19. List the four pairs of...Ch. 11.6 - Prob. 20LOCh. 11.6 - What are the main actions of the abdominal...Ch. 11.7 - Prob. 21LOCh. 11.7 - Prob. 22LOCh. 11.7 - Prob. 17WDLCh. 11.8 - Prob. 23LOCh. 11.8 - Prob. 18WDLCh. 11.8 - Prob. 24LOCh. 11.8 - Prob. 25LOCh. 11.8 - Prob. 19WDLCh. 11.8 - Identify the rotator cuff muscles, and describe...Ch. 11.8 - Prob. 26LOCh. 11.8 - Prob. 27LOCh. 11.8 - Prob. 3WDTCh. 11.8 - What are the muscles in the anterior compartment...Ch. 11.8 - Prob. 22WDLCh. 11.8 - Prob. 28LOCh. 11.8 - Prob. 29LOCh. 11.8 - Prob. 23WDLCh. 11.8 - What muscles in the posterior compartment move the...Ch. 11.8 - Prob. 30LOCh. 11.8 - Prob. 25WDLCh. 11.9 - Prob. 31LOCh. 11.9 - Prob. 32LOCh. 11.9 - Prob. 26WDLCh. 11.9 - Prob. 33LOCh. 11.9 - LEARNING OBJECTIVES
34. Describe the muscles of...Ch. 11.9 - Prob. 27WDLCh. 11.9 - Prob. 35LOCh. 11.9 - Prob. 36LOCh. 11.9 - Prob. 28WDLCh. 11.9 - Prob. 37LOCh. 11.9 - WHAT DO YOU THINK?
4 The extensor digitorum...Ch. 11.9 - Prob. 29WDLCh. 11 - Prob. 1DYBCh. 11 - Prob. 2DYBCh. 11 - _____ 3. When this large muscle contracts, the...Ch. 11 - Prob. 4DYBCh. 11 - Prob. 5DYBCh. 11 - _____ 6. The dorsal interossei muscles in the hand...Ch. 11 - Prob. 7DYBCh. 11 - Prob. 8DYBCh. 11 - Prob. 9DYBCh. 11 - Prob. 10DYBCh. 11 - Prob. 11DYBCh. 11 - Which muscles of facial expression do you use to...Ch. 11 - Distinguish between suprahyoid and infrahyoid...Ch. 11 - What is the effect of contracting the abdominal...Ch. 11 - What movements are possible at the glenohumeral...Ch. 11 - Identify the compartments of the arm (brachium),...Ch. 11 - Prob. 17DYBCh. 11 - Prob. 18DYBCh. 11 - What leg muscles allow a ballet dancer to rise up...Ch. 11 - Which muscles are responsible for foot inversion?Ch. 11 - Prob. 1CALCh. 11 - Prob. 2CALCh. 11 - Prob. 3CALCh. 11 - Prob. 4CALCh. 11 - Prob. 5CALCh. 11 - Prob. 1CSLCh. 11 - While training on the balance beam, Pat slipped...Ch. 11 - Prob. 3CSLCh. 11 - Why is it more difficult for Eric to lift a heavy...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
GCSE PE - ANTAGONISTIC MUSCLE ACTION - Anatomy and Physiology (Skeletal and Muscular System - 1.5); Author: igpe_complete;https://www.youtube.com/watch?v=6hm_9jQRoO4;License: Standard Youtube License