
Anatomy & Physiology
3rd Edition
ISBN: 9781259398629
Author: McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher: Mcgraw Hill Education,
expand_more
expand_more
format_list_bulleted
Question
Chapter 11, Problem 2CAL
Summary Introduction
Introduction:
Muscles are the types of soft tissues that are found in animals and humans. The extrinsic eye muscles are also called extraocular muscles and it helps in the movement of eyes. There are six extrinsic eye muscles such as four rectus muscles and two oblique muscles.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 11 Solutions
Anatomy & Physiology
Ch. 11.1 - LEARNING OBJECTIVE
1. Compare and contrast the...Ch. 11.1 - WHAT DID YOU LEARN?
1 What is the difference...Ch. 11.1 - LEARNING OBJECTIVE
2. Describe and differentiate...Ch. 11.1 - Which muscle is strongera pennate muscle or a...Ch. 11.1 - Prob. 3LOCh. 11.1 - What is the difference between an agonist and a...Ch. 11.2 - LEARNING OBJECTIVES
4. List the seven...Ch. 11.2 - LEARNING OBJECTIVE
5. Give examples of muscles...Ch. 11.2 - What are some words used in muscle names that...Ch. 11.2 - The gluteus maximus muscle gets its name from...
Ch. 11.3 - Prob. 6LOCh. 11.3 - Prob. 7LOCh. 11.3 - Prob. 6WDLCh. 11.3 - Prob. 7WDLCh. 11.3 - Prob. 8LOCh. 11.3 - Prob. 9LOCh. 11.3 - Which extrinsic eye muscles abduct the eye (move...Ch. 11.3 - Prob. 10LOCh. 11.3 - Prob. 11LOCh. 11.3 - Prob. 12LOCh. 11.3 - Prob. 9WDLCh. 11.3 - Prob. 10WDLCh. 11.3 - Prob. 13LOCh. 11.3 - Prob. 1WDTCh. 11.3 - List the four suprahyoid muscles, and describe a...Ch. 11.3 - Prob. 14LOCh. 11.3 - Which neck muscles extend the neck? Which neck...Ch. 11.4 - Prob. 15LOCh. 11.4 - Prob. 16LOCh. 11.4 - Which muscles form the erector spinae, and what...Ch. 11.5 - Prob. 17LOCh. 11.5 - Prob. 18LOCh. 11.5 - Prob. 2WDTCh. 11.5 - Prob. 14WDLCh. 11.5 - How is the diaphragm involved in respiration?Ch. 11.6 - LEARNING OBJECTIVES
19. List the four pairs of...Ch. 11.6 - Prob. 20LOCh. 11.6 - What are the main actions of the abdominal...Ch. 11.7 - Prob. 21LOCh. 11.7 - Prob. 22LOCh. 11.7 - Prob. 17WDLCh. 11.8 - Prob. 23LOCh. 11.8 - Prob. 18WDLCh. 11.8 - Prob. 24LOCh. 11.8 - Prob. 25LOCh. 11.8 - Prob. 19WDLCh. 11.8 - Identify the rotator cuff muscles, and describe...Ch. 11.8 - Prob. 26LOCh. 11.8 - Prob. 27LOCh. 11.8 - Prob. 3WDTCh. 11.8 - What are the muscles in the anterior compartment...Ch. 11.8 - Prob. 22WDLCh. 11.8 - Prob. 28LOCh. 11.8 - Prob. 29LOCh. 11.8 - Prob. 23WDLCh. 11.8 - What muscles in the posterior compartment move the...Ch. 11.8 - Prob. 30LOCh. 11.8 - Prob. 25WDLCh. 11.9 - Prob. 31LOCh. 11.9 - Prob. 32LOCh. 11.9 - Prob. 26WDLCh. 11.9 - Prob. 33LOCh. 11.9 - LEARNING OBJECTIVES
34. Describe the muscles of...Ch. 11.9 - Prob. 27WDLCh. 11.9 - Prob. 35LOCh. 11.9 - Prob. 36LOCh. 11.9 - Prob. 28WDLCh. 11.9 - Prob. 37LOCh. 11.9 - WHAT DO YOU THINK?
4 The extensor digitorum...Ch. 11.9 - Prob. 29WDLCh. 11 - Prob. 1DYBCh. 11 - Prob. 2DYBCh. 11 - _____ 3. When this large muscle contracts, the...Ch. 11 - Prob. 4DYBCh. 11 - Prob. 5DYBCh. 11 - _____ 6. The dorsal interossei muscles in the hand...Ch. 11 - Prob. 7DYBCh. 11 - Prob. 8DYBCh. 11 - Prob. 9DYBCh. 11 - Prob. 10DYBCh. 11 - Prob. 11DYBCh. 11 - Which muscles of facial expression do you use to...Ch. 11 - Distinguish between suprahyoid and infrahyoid...Ch. 11 - What is the effect of contracting the abdominal...Ch. 11 - What movements are possible at the glenohumeral...Ch. 11 - Identify the compartments of the arm (brachium),...Ch. 11 - Prob. 17DYBCh. 11 - Prob. 18DYBCh. 11 - What leg muscles allow a ballet dancer to rise up...Ch. 11 - Which muscles are responsible for foot inversion?Ch. 11 - Prob. 1CALCh. 11 - Prob. 2CALCh. 11 - Prob. 3CALCh. 11 - Prob. 4CALCh. 11 - Prob. 5CALCh. 11 - Prob. 1CSLCh. 11 - While training on the balance beam, Pat slipped...Ch. 11 - Prob. 3CSLCh. 11 - Why is it more difficult for Eric to lift a heavy...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Nervous System - Get to know our nervous system a bit closer, how does it works? | Neurology; Author: FreeMedEducation;https://www.youtube.com/watch?v=6O-0CVAgaEM;License: Standard youtube license