EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 11, Problem 24PDQ
In 1994, telomerase activity was discovered in human cancer cell lines. Although telomerase is not active in human somatic tissue, human somatic cells do contain the genes for telomerase proteins and telomerase RNA. Since inappropriate activation of telomerase may contribute to cancer, why do you think the genes coding for this enzyme have been maintained in the human genome throughout evolution? Are there any types of human body cells where telomerase activation would be advantageous or even necessary? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
n yeast cells, telomerase remains active and maintains telomeres of about 300 base pairs. Propose what would happen to the telomeres over time in a yeast lineage in which the following mutations were created.
The gene encoding the catalytic subunit of the telomerase is deleted.
In cancerous cells, telomeres are substantially longer then telomeres found in non-cancerous cells. As a result a number of scientists who study cancer treatment have become interested in telomerase. Why might telomerase be a good target for anticancer therapies? How might anticancer therapies targeting telomerase work (no need to design an experiment, just brainstorm how the therapy might impact telomeres of cancer cells)?
With age, somatic cells are thought to accumulate genomic "scars"as a
result of the inaccurate repair of double-strand breaks by non
homologous end-joining (NHEJ). Estimates based on the frequency of
breaks in primary human fibroblasts suggest that by age 70 each human
somatic cell may carry some 2000 NHEJ-induced mutations due to
inaccurate repair. If these mutations were distributed randomly around
the genome, how many genes would you expect to be affected? Would
you expect cell function to be compromised? Why or why not? (Assume
that 2% of the genome - 1.5% coding and 0.5% regulatory - is crucial
information.)
Chapter 11 Solutions
EBK CONCEPTS OF GENETICS
Ch. 11 - In the Meselson-Stahl experiment, which of the...Ch. 11 - An alien organism was investigated. When DNA...Ch. 11 - Why might mutations in genes encoding telomerase...Ch. 11 - Although the brother is an immunologically matched...Ch. 11 - Prob. 3CSCh. 11 - HOW DOWE KNOW? In this chapter, we focused on how...Ch. 11 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 11 - Compare conservative, semiconservative, and...Ch. 11 - Describe the role of 15N in the MeselsonStahl...Ch. 11 - Predict the results of the experiment by Taylor,...
Ch. 11 - What are the requirements for in vitro synthesis...Ch. 11 - In Kornbergs initial experiments, it was rumored...Ch. 11 - How did Kornberg assess the fidelity of DNA...Ch. 11 - Which characteristics of DNA polymerase I raised...Ch. 11 - Kornberg showed that nucleotides are added to the...Ch. 11 - What was the significance of the polA1 mutation?Ch. 11 - Summarize and compare the properties of DNA...Ch. 11 - List and describe the function of the ten subunits...Ch. 11 - Distinguish between (a) unidirectional and...Ch. 11 - List the proteins that unwind DNA during in vivo...Ch. 11 - Define and indicate the significance of (a)...Ch. 11 - Outline the current model for DNA synthesis.Ch. 11 - Why is DNA synthesis expected to be more complex...Ch. 11 - Suppose that E. coli synthesizes DNA at a rate of...Ch. 11 - Several temperature-sensitive mutant strains of E....Ch. 11 - While many commonly used antibiotics interfere...Ch. 11 - Describe the end-replication problem in...Ch. 11 - Many of the gene products involved in DNA...Ch. 11 - In 1994, telomerase activity was discovered in...Ch. 11 - The genome of D. melanogaster consists of...Ch. 11 - Prob. 26ESPCh. 11 - DNA polymerases in all organisms add only 5...Ch. 11 - Assume that the sequence of bases shown below is...Ch. 11 - Reiji and Tuneko Okazaki conducted a now classic...Ch. 11 - Consider the drawing of a dinucleotide below. (a)...Ch. 11 - To gauge the fidelity of DNA synthesis, Arthur...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Although several different mammalian species have been cloned, the efficiency of this process is extremely low. Often tens or even hundreds of oocytes must be implanted with donor nuclei to obtain one healthy live birth. Many researchers believe the difficulties with cloning reside in the epigenetic modifications, such as DNA and histone methylation, that occur within various cells during an individual’s life. How do you suspect such modifications might affect the success of an experimentarrow_forwardExpression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? Would the outcome of this experiment differ if the experiment had been performed in a yeast line containing mutations in the H3 or H4 histone tails?arrow_forwardA drug company is trying to develop telomerase inhibitors to treat hepatocellular carcinoma. They test their drugs on the purified telomerase from both humans and mice and find they are very potent inhibitors of enzyme activity. The drugs also inhibit growth of HEPG2 cells which are an immortalized human liver cell line. As a final study before commencing human trials, they test the effect of the drugs on formation of liver tumors in mice treated with a potent hepatocarcinogen. Unfortunately they see no effect of these drugs on development of liver tumors in mice. Explain the fundamental mistake the researchers made in this experiment. What defect might you expect these mice to have if their embryos were treated with these drugs early in development?arrow_forward
- Imagine you are working in a lab that is developing a novelty rose that smells like a stinkhorn mushroom – called the “Grose.” The gene that produces the odorous protein has been isolated from stinkhorn and recombinant DNA containing this gene, a promoter, and a gene that confers resistance to the antibiotic ampicillin has already been produced.After transforming your rose cells, describe the next 2 steps to verify that you have successfully produced this genius gag gift.arrow_forwardYou want to clone the Human Gene A into a plasmid for producing the Protein A in bacteria. GeneA encodes an mRNA of 100 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns. If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is true.arrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forward
- DNA repair systems are responsible for maintaining genomic fidelity in normal cells despite the high frequency with which mutational events occur. What type of DNA mutation is generated by (a) UV radiation and (b) ionizing radiation? Describe the system responsible for repairing each of these types of mutations in mammalian cells. Postulate why a loss of function in one or more DNA repair systems typifies many cancers.arrow_forwardYou want to clone a eukaryotic gene and express the corresponding protein in yeast. However, the protein typically localizes within mitochondria. How will you perform your gene cloning so that the protein is secreted from the cell, rather than localized within yeast mitochondria?arrow_forwardIn a particular organism, there are two similar genes called YFG1 and YFG2. YFG1 is expressed in the liver and not in the pancreas, and YFG2 is expressed in the pancreas but not the liver. Neither YFG1 nor YFG2 is expressed in the heart. If you extract DNA from heart cells, do you expect to see the YFG2 gene? Explain why. Do you expect to see the YFG1 protein when you analyze protein extract from liver cells? And from pancreas cells? And from heart cells? Explain why. Is it possible to produce YFG1 and YFG2 proteins via alternative splicing? Explain one possible way (mechanism) to regulate the expression of YFG1 gene.arrow_forward
- Why do adult human cells (other than germ cells and stem cells) NOT express the enzyme telomerase? In other words what benefit does not having telomerase provide to these cells?arrow_forwardIf you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not? Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?arrow_forwardIf you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What are Mutations and what are the different types of Mutations?; Author: Science ABC;https://www.youtube.com/watch?v=I16YlE8qTBU;License: Standard youtube license