Concept explainers
If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?
TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
a. | Two |
b. | Three |
c. | Four |
d. | Five |

Introduction:
Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.
Answer to Problem 1MCQ
Correct answer:
GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.
Explanation of Solution
Reason for correct answer:
Option c. is given as, “Four.”
Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.
Reason for incorrect answer:
Option a. is given as, “Two.”
GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.
Option b. is given as, “Three.”
When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.
Option d. is given as, “Five.”
GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.
Hence, the options a., b., and d. are incorrect.
GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.
Want to see more full solutions like this?
Chapter 11 Solutions
BIOLOGY:ESSENTIALS (LL)-W/ACCES>CUSTOM<
- Use the following information to answer the question(s) below. Martin Wikelski and L. Michael Romero (Body size, performance and fitness in Galápagos marine iguanas, Integrative and Comparative Biology 43 [2003]:376-86) measured the snout-to-vent (anus) length of Galápagos marine iguanas and observed the percent survival of different-sized animals, all of the same age. The graph shows the log snout-vent length (SVL, a measure of overall body size) plotted against the percent survival of these different size classes for males and females. Survival (%) 100- 80- 60- 40- 20- 0+ 1.9 T 2 2.1 2.2 2.3 2.4 2.5 2.6 2.7 Log SVL (mm) 19) Examine the figure above. What type of selection for body size appears to be occurring in these marine iguanas? A) directional selection B) stabilizing selection C) disruptive selection D) You cannot determine the type of selection from the above information. 3arrow_forward24) Use the following information to answer the question below. Researchers studying a small milkweed population note that some plants produce a toxin and other plants do not. They identify the gene responsible for toxin production. The dominant allele (T) codes for an enzyme that makes the toxin, and the recessive allele (t) codes for a nonfunctional enzyme that cannot produce the toxin. Heterozygotes produce an intermediate amount of toxin. The genotypes of all individuals in the population are determined (see table) and used to determine the actual allele frequencies in the population. TT 0.49 Tt 0.42 tt 0.09 Refer to the table above. Is this population in Hardy-Weinberg equilibrium? A) Yes. C) No; there are more homozygotes than expected. B) No; there are more heterozygotes than expected. D) It is impossible to tell.arrow_forward30) A B CDEFG Refer to the accompanying figure. Which of the following forms a monophyletic group? A) A, B, C, and D B) C and D C) D, E, and F D) E, F, and Garrow_forward
- Molecular Biology Question. Please help with step solution and explanation. Thank you: The Polymerase Chain Reaction (PCR) reaction consists of three steps denaturation, hybridization, and elongation. Please describe what occurs in the annealing step of the PCR reaction. (I think annealing step is hybridization). What are the other two steps of PCR, and what are their functions? Next, suppose the Tm for the two primers being used are 54C for Primer A and 67C for Primer B. Regarding annealing step temperature, I have the following choices for the temperature used during the annealing step:(a) 43C (b) 49C (c) 62C (d) 73C Which temperature/temperatures should I choose? What is the corresponding correct explanation, and why would I not use the other temperatures? Have a good day!arrow_forwardUsing the data provided on the mean body mass and horn size of 4-year-old male sheep, draw a scatterplot graph to examine how body mass and horn size changed over time.arrow_forwardPlease write a 500-word report about the intake of saturated fat, sodium, alcoholic beverages, or added sugar in America. Choose ONE of these and write about what is recommended by the Dietary Guidelines for Americans (guideline #4) and why Americans exceed the intake of that nutrient. Explain what we could do as a society and/or individuals to reduce our intake of your chosen nutrient.arrow_forward
- Write a 500-word report indicating how you can change the quantity or quality of TWO nutrients where your intake was LOWER than what is recommended by the Dietary Guidelines for Americans and/or the DRIs. Indicate how the lack of the nutrient may affect your health. For full credit, all of the following points must be addressed and elaborated on in more detail for each nutrient: The name of the nutrient At least 2 main functions of the nutrient (example: “Vitamin D regulates calcium levels in the blood and calcification of bones.”) Your percent intake compared to the RDA/DRI (example “I consumed 50% of the RDA for vitamin D”) Indicate why your intake was below the recommendations (example: “I only had one serving of dairy products and that was why I was below the recommendations for vitamin D”) How would you change your dietary pattern to meet the recommendations? – be sure to list specific foods (example: “I would add a yogurt and a glass of milk to each day in order to increase my…arrow_forwardWhy are nutrient absorption and dosage levels important when taking multivitamins and vitamin and mineral supplements?arrow_forwardI'm struggling with this topic and would really appreciate your help. I need to hand-draw a diagram and explain the process of sexual differentiation in humans, including structures, hormones, enzymes, and other details. Could you also make sure to include these terms in the explanation? . Gonads . Wolffian ducts • Müllerian ducts . ⚫ Testes . Testosterone • Anti-Müllerian Hormone (AMH) . Epididymis • Vas deferens ⚫ Seminal vesicles ⚫ 5-alpha reductase ⚫ DHT - Penis . Scrotum . Ovaries • Uterus ⚫ Fallopian tubes - Vagina - Clitoris . Labia Thank you so much for your help!arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning





