Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 11, Problem 12P
Interpretation Introduction
Interpretation:
The density
Concept introduction:
The strands of the DNA molecule contain the complementary pairs of bases. The adenine is complementary
Isopycnic centrifugation is a technique that is used for the separation of molecules in solution on the basis of differences in their densities.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Please help me!
Chapter 11 Solutions
Biochemistry
Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Prob. 3PCh. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Prob. 9PCh. 11 - Prob. 10P
Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Prob. 12PCh. 11 - Prob. 13PCh. 11 - Prob. 14PCh. 11 - Answers to all problems are at the end of this...Ch. 11 - Prob. 16PCh. 11 - Prob. 17PCh. 11 - Prob. 18PCh. 11 - Prob. 19PCh. 11 - Prob. 20PCh. 11 - Prob. 21PCh. 11 - Prob. 22PCh. 11 - Prob. 23P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Chargaff’s Rules for the Base Composition of DNA Chargaff’s results (Table 10.1) yielded a molar ratio of 1 1.29 for A to G in ox DNA, 1.43 for T to C, 1.04 for A to T, and 1.00 for G to C. Given these values, what are the approximate mole fractions of A. C, G. and T in ox DNA?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Helical Parameters I A 41.5-nm-long duplex DNA molecule in the B conformation adopts the A-conformation upon dehydration. How long is it now? What is its approximate number of base pairs?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. DNA Supercoiling Parameters A “relaxed,� circular, double-stranded DNA molecule (1600 bp) is in a solution where conditions favor 10 bp per turn. What is the value of L0 for this DNA molecule? Suppose DNA gyrase introduces 12 negative supercoils into this molecule. What are the values of L, W, and T now? What is the superhelical density, ?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B-and Z-DNA Helical Parameters II If 80% of the base pairs in a duplex DNA molecule (12.5 kbp) are in the B-conformation and 20% are in the Z-conformation, what is the length of the molecule?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Supercoiling Parameters Suppose one double helical turn of a superhelical DNA molecule changes conformation from B- to Z-form. What are the changes in L, W, and T? Why do you suppose the transition of DNA from B- to Z-form is favored by negative supercoiling?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. (Historical Context) The Third Person of the -Helix Publication Who was Herman Branson? What was his role in the elucidation of the structure of the or-helix'.' Did he receive sufficient credit and recognition for his contributions? And how did the rest of his career unfold? Do a Google search on Herman Branson to learn about his life, and read the article by David Eisenberg under Further Reading. You may also wish to examine the original paper by Pauling, Corey, and Branson, as well as the following Web site: http://www.pirns. org/sitelmisclclassicsl..shtml Pauling, L., Corey, R. B., and Branson, H. R., 1951. The structure of proteins: two hydrogen-bonded helical configurations of the polypeptide chain. Proceedings of the National Academy of Sciences, USA 37:235-240.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculate the Number of Nucleosomes in a Human Diploid Cell Assume that there is one nucleosome for every 200 bp of eukaryotic DNA. How many nucleosomes are there in a diploid human cell? Nucleosomes in be approximated a disks 11 nm in diameter and 6 nm long. If all the DNA molecules in a diploid human cell are in the B-conformation, what is the sum of their lengths? If this DNA is now arrayed on nucleosomes in the beads-on-a-string motif, what would be the approximate total height of the nucleosome column if these disks were stacked atop one another?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculating Tms and Separating DNA Molecules That Differ in G:C Content At 0.2 M Na+, the melting temperature of double-stranded DNA is given by the formula, Tm = 69.3 + 0 41 (% G + C). The DNAs from mice and rats have (G + C) contents of 44% and 40%, respectively. Calculate the Tms for these DNAs in 0.2 M NaCl. If samples of these DNAs were inadvertently mixed, how might they be separated from one another?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. An Estimation of Minimal Genome Size for a Living Cell Studies of existing cells to determine the minimum number of genes for a living cell have suggested that 206 genes are sufficient. If the ratio of protein-coding genes to non-protein-coding genes is the same in this minimal organism as the genes of Mycoplasma genitulium, how many proteins are represented in these 206 genes. How many base pairs would be required to form the genome of this minimal organism if the genes are the same size as M genilalium genes? (Section 1.5)arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Base Sequence in the Two Polynucleotide Chairs of a DNA Double Helix Is Complementary Adhering to the convention of writing nucleotide sequences in the 5' 3' direction, what is the nucleotide sequence of the DNA strand that is complementary to d-ATCGCAACTGTCACTA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY