Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10.6, Problem 1MQ
- During transformation a cell usually incorporates only one or a few fragments of DNA. Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
In apoptosis, a process of programmed cell death, the cell undergoes controlled degradation of cellular components including nuclear DNA
Researchers have noted that if the DNA is isolated from an apoptotic cell, it appears as distinct bands of multiples of approximately 145 bases
in length. Why does this occur?
Multiple Choice
There is a specific DNase that digests DNA every 145 base pairs.
DNA sequences that appear every 145 base pairs allows for easier DNA breakage.
DNA that is wrapped around the histones is not being degraded.
DNA is coated with transcription factors every 145 base pairs.
Look at the picture carefully below and imagine inside a cell nucleus.
a) encircle and name the parts where DNA is most accessible and least accessible
b) how nucleosome positioning or spacing can interfere with DNA accessiblity
A major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?
Chapter 10 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 10.1 - Distinguish between a mutation and a mutant.Ch. 10.1 - Distinguish between screening and selection.Ch. 10.2 - Do missense mutations occur in genes encoding...Ch. 10.2 - Why do frameshift mutations generally have more...Ch. 10.3 - Why does the Ames test measure the rate of...Ch. 10.3 - Which class of mutation, missense or nonsense, is...Ch. 10.4 - Prob. 1MQCh. 10.4 - Prob. 2MQCh. 10.4 - Prob. 3MQCh. 10.5 - Prob. 1MQ
Ch. 10.5 - Prob. 2MQCh. 10.5 - Prob. 3MQCh. 10.6 - During transformation a cell usually incorporates...Ch. 10.6 - Prob. 2MQCh. 10.7 - Prob. 1MQCh. 10.7 - What is the major difference between generalized...Ch. 10.7 - Why is phage conversion considered beneficial to...Ch. 10.8 - In conjugation, how are donor and recipient cells...Ch. 10.8 - Explain how rolling circle DNA replication allows...Ch. 10.8 - Prob. 3MQCh. 10.9 - In conjugation involving the F plasmid of...Ch. 10.9 - Prob. 2MQCh. 10.9 - Prob. 3MQCh. 10.10 - Why is it usually more difficult to select...Ch. 10.10 - Why do penicillins not kill species of Archaea?Ch. 10.11 - Prob. 1MQCh. 10.11 - What is the significance of the terminal inverted...Ch. 10.11 - How can transposons be used in bacterial genetics?Ch. 10.12 - Why is the CRISPR system considered a prokaryotic...Ch. 10.12 - Prob. 2MQCh. 10 - Write a one-sentence definition of the term...Ch. 10 - Prob. 2RQCh. 10 - Prob. 3RQCh. 10 - Prob. 4RQCh. 10 - Prob. 5RQCh. 10 - What are heteroduplex regions of DNA and what...Ch. 10 - QExplain why recipient cells do not successfully...Ch. 10 - QExplain how a generalized transducing particle...Ch. 10 - QWhat is a sex pilus and which cell type, F or F+,...Ch. 10 - Prob. 10RQCh. 10 - Prob. 11RQCh. 10 - Prob. 12RQCh. 10 - QExplain why incoming DNA recognized by a short...Ch. 10 - A constitutive mutant is a strain that...Ch. 10 - Although a large number of mutagenic chemicals are...Ch. 10 - Why is it difficult in a single experiment to...Ch. 10 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Why do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardEach peak in a chromatogram corresponds to: A fluorescent ddNTP which has been released from the DNA fragment resulting in the termination of synthesis A fluorescent dNTP which has been released from the DNA fragment resulting in the termination of synthesis A fluorescent dNTP which has been incorporated into the DNA fragment resulting in the termination of synthesis. A fluorescent ddNTP which has been incorporated into the DNA fragment resulting in the termination of synthesisarrow_forward
- Draw replication forks that show what you would expect to see if a cell were unable to make the following enzymes: DNA Polymerase Helicase Primase Ligasearrow_forwardBackground: DNA nucleotides (i.e A, T, G, and C) are naturally found in a paired, or bonded, arrangement (i.e. the double helix) within the nucleus of every cell. This structure makes the process of replication that occurs prior to mitosis and meiosis very reliable. The purpose of DNA, though, is not simply to make copies of itself, but to provide a set of instructions for the synthesis or "construction" of biomolecules, such as proteins. Why is transcription (i.e. the formation of an RNA copy of a given gene) a necessary step in the "construction" process highlighted above? What is the cell looking to ultimately do with this RNA information?arrow_forwardGive the name of the enzyme that catalyzes each of the following reactions:(a) Makes a DNA strand from a DNA template. (b) Makes a DNA strand from an RNA template. (c) Makes an RNA strand from a DNA templatearrow_forward
- If mutations occur in DNA, there are several mechanisms by which a cell can repair the defect. One method that can be used is nucleotide extision repair. All of the following characterize nucleotide excision repair, except: DNA ligase will replace the excised DNA and seal the backbone Enzymes can cleave the damaged region DNA can be opened to form a bubble so proteins can access the damaged DNA Can identify thymine dimersarrow_forwardTo promote genetic diversity in bacteria, it has been found that some species have a genetic mechanism that allows them to increase their mutation rate during DNA replication. A scientist hypothesizes that the functions of the following two enzymes would be impacted by this mechanism. In each case, state if you agree and provide a reason for your answer. i) DNA primase ii) DNA polymerase IIIarrow_forwardHow important and useful to the cell is the ability of the DNA to assume various forms? Why are these various forms necessary?arrow_forward
- Explain how cells activate nucleic acids for polymerization. Explain why DNA is stable and why its structure dictates its replication mechanism. Explain why many RNA molecules exhibit tertiary structure, while most DNA molecules do not. Explain how DNA replication occurs from structural and enzymatic perspectives. Develop an understanding of nucleic acid biology outside a natural biological context (such as PCR, etc.)arrow_forwardShown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to mix with genomic DNA that has been denatured by boiling, and the two molecules are allowed to hybridize. The DNA strand is presumed to be the lighter-shaded one on the top. Note that only one strand of DNA is shown. This result was the first evidence for which of the following processes? a Replication b Transcription c Translation d Splicingarrow_forwardIn one, simple sentence define the function of the following 1. Helicase = 2. Alpha subunit of DNA polymerase III =arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license