Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 4AQ
Summary Introduction
To discuss:
The insertion of transposable elements within a gene can cause mutations. Transposable elements disrupt the continuity of the gene. However, introns also disrupt the continuity of the gene, but the gene can be functional. Why the gene inactivation is caused by only the presence of transposable elements but not introns.
Concept introduction:
Transposable elements are known as stretches of DNA molecules and they can move from one place to another place. Generally, transposable elements are inserted into the other DNA material, for examples, the chromosome, the plasmid, and the viral genome. Transposable elements usually do not contain the origin of replication, therefore, they replicate within the host DNA into which transposable elements are inserted. When the host
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.
For a specific type of mutation at a given location in a particular gene, identify whether it will affect the size of the mRNA, the protein, or both. How would the mutant appear on a gel in comparison to the original
) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).
Chapter 10 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 10.1 - Distinguish between a mutation and a mutant.Ch. 10.1 - Distinguish between screening and selection.Ch. 10.2 - Do missense mutations occur in genes encoding...Ch. 10.2 - Why do frameshift mutations generally have more...Ch. 10.3 - Why does the Ames test measure the rate of...Ch. 10.3 - Which class of mutation, missense or nonsense, is...Ch. 10.4 - Prob. 1MQCh. 10.4 - Prob. 2MQCh. 10.4 - Prob. 3MQCh. 10.5 - Prob. 1MQ
Ch. 10.5 - Prob. 2MQCh. 10.5 - Prob. 3MQCh. 10.6 - During transformation a cell usually incorporates...Ch. 10.6 - Prob. 2MQCh. 10.7 - Prob. 1MQCh. 10.7 - What is the major difference between generalized...Ch. 10.7 - Why is phage conversion considered beneficial to...Ch. 10.8 - In conjugation, how are donor and recipient cells...Ch. 10.8 - Explain how rolling circle DNA replication allows...Ch. 10.8 - Prob. 3MQCh. 10.9 - In conjugation involving the F plasmid of...Ch. 10.9 - Prob. 2MQCh. 10.9 - Prob. 3MQCh. 10.10 - Why is it usually more difficult to select...Ch. 10.10 - Why do penicillins not kill species of Archaea?Ch. 10.11 - Prob. 1MQCh. 10.11 - What is the significance of the terminal inverted...Ch. 10.11 - How can transposons be used in bacterial genetics?Ch. 10.12 - Why is the CRISPR system considered a prokaryotic...Ch. 10.12 - Prob. 2MQCh. 10 - Write a one-sentence definition of the term...Ch. 10 - Prob. 2RQCh. 10 - Prob. 3RQCh. 10 - Prob. 4RQCh. 10 - Prob. 5RQCh. 10 - What are heteroduplex regions of DNA and what...Ch. 10 - QExplain why recipient cells do not successfully...Ch. 10 - QExplain how a generalized transducing particle...Ch. 10 - QWhat is a sex pilus and which cell type, F or F+,...Ch. 10 - Prob. 10RQCh. 10 - Prob. 11RQCh. 10 - Prob. 12RQCh. 10 - QExplain why incoming DNA recognized by a short...Ch. 10 - A constitutive mutant is a strain that...Ch. 10 - Although a large number of mutagenic chemicals are...Ch. 10 - Why is it difficult in a single experiment to...Ch. 10 - Prob. 4AQ
Knowledge Booster
Similar questions
- The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 в в 11 E2 12 E4 Exon (E) Intron (1)arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 11 E2 12 ЕЗ 13 E4 Exon (E) Intron (I)arrow_forward
- The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 867 nucleotides in length, and the other is 685 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 867 and 685 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 150 nucleotides.arrow_forwardOne procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why does using them make sense based on the processing (or modification) of precursor mRNA to get mature mRNA?arrow_forwardThe Reverse Transcriptase and Integrase enzymes produced by Retrotransposons sometimes mistakenly act on cellular mRNAs and generate a DNA intermediate that becomes integrated into the genome (which can lead to formation of new pseudogenes). Would you predict that a newly transposed element produced from an mRNA will generally be transcribed after its integration? Explain your answer.arrow_forward
- The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never madearrow_forwardIntrons are often very large and the cell has devoted mechanisms of eliminating them once they are excised from the pre-mRNA. Following intron excision, what specific ribonucleolytic enzymes or complexes contribute to eliminating the intron RNA immediately after it is excised from the pre-mRNA? Briefly describe the role of each step/enzyme and how it affects its RNA substratearrow_forwardA normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)arrow_forward
- The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold)arrow_forwardOnce transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your favorite bacterial species. After mutagenizing the bacteria, you notice that the mRNA is 800 nucleotides long. Which of the following could be the mutated that would explain your observations? a mutation introducing a new rut site in gene X a mutation in the Shine-Dalgarno sequence a mutation in the polyA addition site a mutation in the operatorarrow_forwardFor the ovalbumin gene shown in Figure 14.3, where would the 5′ untranslated region and 3′ untranslated regions be located in the DNA and in the RNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning